ID: 1120130216

View in Genome Browser
Species Human (GRCh38)
Location 14:80797989-80798011
Sequence TCTCAGCCACTAAAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120130216 Original CRISPR TCTCAGCCACTAAAGCAGAA TGG Intronic
900974787 1:6010342-6010364 CCTCAGCCTCGAAAGCAGATGGG - Intronic
901739038 1:11330363-11330385 TCTCTGTGACTACAGCAGAAGGG + Intergenic
902193008 1:14776818-14776840 CCTCAGCCACTGAAGCAGCTAGG - Intronic
903674188 1:25054110-25054132 TCCCAGCAGCCAAAGCAGAAAGG - Intergenic
903759774 1:25689792-25689814 ACTCAGCCAGCACAGCAGAATGG - Intronic
905041010 1:34958481-34958503 TCTCAGCCACTTGAGCAGCTGGG + Intergenic
905452663 1:38066946-38066968 TCTCAGCCACCAAAGTAGCTGGG + Intergenic
905988850 1:42314364-42314386 TCTCAGCCTCTCAAGTAGATAGG + Intronic
906334341 1:44915475-44915497 TCTCAGCCACCTAAGCAGCTGGG + Intronic
906923639 1:50091072-50091094 TCTGATTCAGTAAAGCAGAAGGG + Intronic
906929975 1:50159748-50159770 TCTAAGCCAGTAGAGAAGAATGG + Intronic
907820177 1:57959785-57959807 TCTCAGCTTCCAAAGCATAAAGG - Intronic
907836793 1:58117150-58117172 TCTCAGCAACTAATGCACACCGG + Intronic
909937194 1:81565753-81565775 TCTGGGCCACTAAAGAAGAAAGG - Intronic
910326760 1:86017849-86017871 TGTGAGCCAGGAAAGCAGAAAGG - Intronic
910830355 1:91455019-91455041 TCTCAGCTCCTAAAGCAGTTTGG - Intergenic
911292211 1:96071108-96071130 TCCCAGCTATTACAGCAGAACGG + Intergenic
912104200 1:106250158-106250180 TCACAGTCACTCAAGAAGAAGGG + Intergenic
912670172 1:111617925-111617947 TCTCAGCCTCCAAAGCAGCTGGG - Intronic
913353285 1:117887042-117887064 TCTCAGCCTCCAAAGCAGCTGGG + Intronic
913364318 1:118018917-118018939 TCTCAGCCACTAGAGTAGCTGGG - Intronic
914492721 1:148162258-148162280 TCACAGCCACTACACCAGCACGG + Intergenic
915141523 1:153771302-153771324 TCTCAGGCAAGAGAGCAGAAAGG - Intronic
916033643 1:160901609-160901631 ACTCAGCCTCCAAAGGAGAAGGG - Intergenic
916435219 1:164771817-164771839 TAGCAGCCATTAAAGCTGAAAGG + Intronic
916632604 1:166632824-166632846 TCTCAGTAACTCAAGTAGAATGG + Intergenic
916962287 1:169901366-169901388 TCCCAGCCCCTCAAGCAGCAAGG + Intergenic
917318140 1:173750423-173750445 CCTCAGCCACTGGAGTAGAAGGG + Intronic
918356827 1:183712758-183712780 TCCCAGCTCCTAAAGTAGAATGG + Intronic
919507660 1:198419803-198419825 TTTTAGCAACTAAAGCAAAAGGG + Intergenic
919793160 1:201305399-201305421 CCTCAGCCTCTCAAGCAGATGGG - Intronic
919829888 1:201532883-201532905 TCGCAGCCTCTAAATCTGAACGG + Intergenic
921229494 1:213053949-213053971 TCTCAGCCACTCAAGTAGCTGGG + Intronic
922656506 1:227389116-227389138 CCTCATCCACAAAAGCAGGATGG + Intergenic
923640471 1:235754346-235754368 CCTCAGCCTCTCAAGCAGATGGG + Intronic
1062860999 10:809347-809369 TCTGAACCACTAAAACACAAAGG + Exonic
1063649723 10:7921263-7921285 TCTCAGCAACTAAAGTGGAAAGG - Intronic
1063960488 10:11301771-11301793 TCTCTGGCACATAAGCAGAAGGG + Intronic
1065338764 10:24682978-24683000 TCTCAGCCTCTCAAGCAGCTGGG - Intronic
1065591593 10:27267938-27267960 TCTCAGCCTCCCAAGCAGATGGG - Intergenic
1066648632 10:37635223-37635245 GCTCAGCCAAGAGAGCAGAAGGG - Intergenic
1067262644 10:44707604-44707626 GCTCAGCCACTAGAGCTGACAGG + Intergenic
1067492279 10:46721449-46721471 TCACAGCTACTAAAGCAAGAGGG + Intergenic
1067602384 10:47618935-47618957 TCACAGCTACTAAAGCAAGAGGG - Intergenic
1067941618 10:50661424-50661446 TCTGAGGCACTGGAGCAGAAGGG - Intergenic
1068031640 10:51711959-51711981 CCTCAGCCATGAATGCAGAATGG - Intronic
1068274939 10:54782642-54782664 GCTCTGCCACTAAAGGAGATGGG - Intronic
1068652201 10:59534841-59534863 TCTAAGCCACTAAAGTATAAAGG - Intergenic
1069816473 10:71198333-71198355 TCTTAGACACTACAGAAGAAAGG + Intergenic
1070862854 10:79686383-79686405 TCTGAGGCACTGGAGCAGAAGGG - Intergenic
1071653738 10:87424345-87424367 TCACAGCTACTAAAGCAAGAGGG - Intergenic
1074820581 10:117175346-117175368 TCTCAGCCCCGCAAGCAGATTGG + Intergenic
1075565792 10:123503220-123503242 TTTCAGAGACTAAAGCAGCAGGG + Intergenic
1075687543 10:124375093-124375115 TTTCAGCAACTATATCAGAAAGG + Intergenic
1077493995 11:2876802-2876824 CCTTTGCCACTCAAGCAGAAAGG + Intergenic
1077513322 11:2984041-2984063 TCTCAGCCACTCAAGTAGCTGGG - Intronic
1078475617 11:11626689-11626711 TATAAGCCACTAAAACAGAGGGG + Intergenic
1078639484 11:13081828-13081850 ACTCAGCAAATAAGGCAGAAGGG - Intergenic
1078649214 11:13171745-13171767 TCTCAGCCTCTGTAGCAGGAAGG - Intergenic
1079613427 11:22461337-22461359 TCTCAGCCAAGAAATAAGAATGG - Intergenic
1080127145 11:28749004-28749026 TCTCAGCCACGACCTCAGAAGGG - Intergenic
1082265145 11:50109986-50110008 CCTCAGCCACTCAAGTAGCAGGG - Intergenic
1083878410 11:65536764-65536786 TCTCAGCCACTGATGCAGCTAGG - Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1085920525 11:80949921-80949943 TCTCAGCCCCTAAAGTAGCTAGG - Intergenic
1086986239 11:93252164-93252186 CCTTAGCCACTGAAGCACAAAGG - Intergenic
1087209697 11:95434491-95434513 GCTCAGTCACTAAAGAAAAAGGG - Intergenic
1087256808 11:95965183-95965205 ACTTATCCACTAAAGGAGAAGGG + Intergenic
1088491394 11:110391435-110391457 TCTCAGCCTCTAAAGTAGCTGGG - Intergenic
1088869271 11:113877353-113877375 CCTCAGCCTCTGAAGCAGCAGGG + Intergenic
1089266991 11:117271013-117271035 TCTCAGCCACCCAAGTAGATGGG + Intronic
1089921851 11:122216419-122216441 CCTCATCCACTTAAGCAGTAAGG + Intergenic
1091146604 11:133285459-133285481 TCACAGCAACTAAAACAGACCGG - Intronic
1093933475 12:24977323-24977345 GCTCTGCCACTAAGGAAGAAAGG + Intergenic
1094705517 12:32910635-32910657 TCTCAGCCTCCCAAGCAGATGGG - Intergenic
1094756009 12:33469132-33469154 TCTCATTATCTAAAGCAGAAAGG - Intergenic
1095046605 12:37514399-37514421 TCTCAGCCTCCCAAGTAGAAGGG - Intergenic
1095505297 12:42890955-42890977 CCTCAGCCTCTAAAGCAGCTGGG + Intergenic
1098013361 12:66078186-66078208 TCTCAGCAACTTTAGTAGAAAGG + Intergenic
1098342693 12:69469024-69469046 CCTCAGCCACAAAATCAGAAAGG - Intergenic
1099958897 12:89378069-89378091 TATAAGCCACAAAGGCAGAAGGG - Intergenic
1100196991 12:92257309-92257331 TCTCAGCCACTGAAGTAGCTGGG + Intergenic
1100616850 12:96237468-96237490 TCTCTGCCATTGAAGCAGAGGGG - Intronic
1101820980 12:108184153-108184175 TCACAGCCATCAAAGCAGGAGGG - Intronic
1102178146 12:110891529-110891551 TCTCAGCCTCTCAAGCAGTTGGG - Intronic
1102377001 12:112430542-112430564 TCTCAGCCTCTAGAGTAGATGGG + Intronic
1103287407 12:119813964-119813986 TCCCAGTGACCAAAGCAGAAAGG - Intronic
1103446240 12:120996927-120996949 TCTCAGCAACTCAAGCAGGGAGG + Intronic
1104962448 12:132494621-132494643 TCACAGACACCAAACCAGAATGG - Intronic
1107471211 13:40692835-40692857 TCTCAGCCACTTAAGTAGCTGGG - Intergenic
1109211303 13:59538571-59538593 TCTCCTCTCCTAAAGCAGAAGGG + Intergenic
1110012676 13:70357426-70357448 CCTCAGCCCCCAAAGCAGCAGGG - Intergenic
1111235239 13:85400630-85400652 TCCCACCCACTAAGGAAGAATGG + Intergenic
1112750746 13:102581021-102581043 TCACAGCCATTTAAGCAAAAAGG + Intergenic
1113489554 13:110680426-110680448 TTCCAGCAAATAAAGCAGAATGG + Intronic
1115257928 14:31422335-31422357 CCTCAGCCACTCAAGTAGCAGGG + Intronic
1116290898 14:43038737-43038759 CCTCAGCCACTCAAGCAGCTAGG + Intergenic
1116510485 14:45739576-45739598 TCTTAGTCACTCAAGTAGAAAGG - Intergenic
1117263951 14:54066299-54066321 CCTCTGCCACTAAATGAGAAAGG - Intergenic
1117296634 14:54386446-54386468 TTTATGCCACTTAAGCAGAAAGG - Intergenic
1117305743 14:54471527-54471549 CCTCAGCCACTCAAGCAGCTGGG + Intergenic
1117820200 14:59641071-59641093 CCTCAGCCTCTAAAGCAGCTAGG + Intronic
1118674379 14:68167449-68167471 TCTCATACAATAAAGCAGGAAGG - Intronic
1118746285 14:68775879-68775901 TCTAAGCAACGAAAGCAGATGGG + Intergenic
1120130216 14:80797989-80798011 TCTCAGCCACTAAAGCAGAATGG + Intronic
1120166631 14:81208239-81208261 TCCCAGCCACTCCAGCTGAAAGG + Intronic
1120893668 14:89510825-89510847 CCTCAGCCACTAAAGTAGCTGGG - Intronic
1121466696 14:94120209-94120231 GCTCAGCCACTAGAGCAGCATGG + Intergenic
1122851908 14:104538488-104538510 TCTCAGCCTCCAAAGCAGCTGGG + Intronic
1124452539 15:29809415-29809437 TCTCAACCAATAAAGCTGCAAGG + Intronic
1125329311 15:38566276-38566298 TCACAGCCACAGATGCAGAAGGG + Intergenic
1126459507 15:48900197-48900219 TCTCATCTCCTAAAGAAGAAGGG + Intronic
1126506289 15:49407311-49407333 TCCCAGCGACTCAAGGAGAATGG - Intronic
1127325475 15:57890575-57890597 ACTCAGAGACTGAAGCAGAATGG - Intergenic
1130289085 15:82580965-82580987 CCTCAGCCTCTAAAGTAGATGGG + Intronic
1132535726 16:478848-478870 TCTCAGCCACCAAAGTAGCTGGG - Intronic
1133909469 16:10051849-10051871 GCTCAGACATTTAAGCAGAAGGG + Intronic
1137844254 16:51671595-51671617 TCTCAGACATTTAAGTAGAAAGG + Intergenic
1138581784 16:57946330-57946352 TCCCAGCCCCAAAAGCAGGAAGG + Intronic
1139216669 16:65132382-65132404 TCTTAGCCACCACAACAGAAAGG - Intergenic
1139634870 16:68252295-68252317 TATCAGCCACTGAAGCTGACAGG - Intronic
1140056486 16:71530319-71530341 CCTAAGGCACTAAAACAGAAGGG + Intronic
1140315137 16:73889131-73889153 TCTATGCCAATAAAGAAGAAAGG - Intergenic
1142117144 16:88364847-88364869 TCTCAGCCTCTCAAGTAGATGGG - Intergenic
1142211869 16:88812260-88812282 TCTCGGCCAATAAAGGAGAAAGG - Intergenic
1142788638 17:2245498-2245520 TCTCAGCCACTCAAGTAGCTGGG + Intronic
1144141752 17:12356296-12356318 TGTCAGCCAATAAAGCAGATGGG + Intergenic
1144264835 17:13558161-13558183 TCTCAGCCTCCCAAGCAGCAAGG - Intronic
1145999789 17:29124364-29124386 TCTCAGCCACTGGAGCCCAAGGG - Intronic
1149813844 17:59704222-59704244 TGTCAGTCACTAAATCAGACAGG - Intronic
1150648167 17:66992763-66992785 TCCCAGACACTAAAGCATCATGG + Intronic
1152500382 17:80704478-80704500 TCTCAGATAGCAAAGCAGAAAGG + Intronic
1153053462 18:922701-922723 TCGAATCCACCAAAGCAGAAAGG - Intergenic
1153820865 18:8830312-8830334 TTCCAGCCACAAAAGCAGCAGGG + Intronic
1155824382 18:30420472-30420494 TCTCATCCACAAAAGCAATAGGG + Intergenic
1156693207 18:39733610-39733632 TCTCAGCCTCTCAAGTAGCAGGG - Intergenic
1156756021 18:40527070-40527092 CCTCAGCCTCTCAAGCAGATGGG + Intergenic
1157420680 18:47545336-47545358 TCTTATCCACTAGATCAGAAAGG + Intergenic
1157660556 18:49438551-49438573 ACTCCGGCACAAAAGCAGAAAGG + Intronic
1158049629 18:53201065-53201087 TCTCTCCCACTAGAGCACAATGG - Intronic
1158441379 18:57477261-57477283 TCACAGCCACAACATCAGAATGG + Exonic
1159958047 18:74533692-74533714 TCTGACCCACCAAAGAAGAAAGG + Intergenic
1161556037 19:4943277-4943299 TCTCACCCACTCAAGCAACATGG - Intronic
1162319132 19:9960409-9960431 TCTCAGCTGCTGAAGCAGACGGG + Exonic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163446906 19:17352360-17352382 CCTCAGCCACTAGGGCAGGAAGG + Exonic
1165167791 19:33869291-33869313 TCTCTGCCACAAAACCAGGAAGG + Intergenic
1165638252 19:37362285-37362307 GCTTTGCCACTAAAGCAGAATGG - Exonic
1165733515 19:38161608-38161630 TCTCAGCCTCTCAAGCAGCTGGG - Intronic
1166087447 19:40486483-40486505 CCTCAGCCACTCAAGGAGATGGG + Intronic
926855718 2:17253748-17253770 TATCTGTCACTAAACCAGAACGG + Intergenic
927060581 2:19415825-19415847 TCTCCACCATTAAAGCATAAAGG + Intergenic
928077707 2:28280172-28280194 TCTCAGCCTCTCAAGCAGCTGGG + Intronic
928370809 2:30738991-30739013 TCCCAGCCACTGAAGCAAAAAGG + Intronic
929817054 2:45241131-45241153 TCTCAGTTACATAAGCAGAATGG + Intergenic
930031482 2:47060752-47060774 GCTCAGCTGCAAAAGCAGAAGGG - Exonic
930628894 2:53730881-53730903 TCTCAGTCACAAAATTAGAAAGG + Intronic
931282072 2:60803426-60803448 TCTCAGCCTCTCAAGTAGCAGGG - Intergenic
931331139 2:61285369-61285391 TCTCAGCCTCCAAAGTAGATGGG - Intronic
933346239 2:81089094-81089116 CCTCAGCCACTAAAGTAGCTGGG - Intergenic
933721934 2:85402580-85402602 TCTCAGCCACCCAAGCAGCTGGG + Intronic
935013814 2:99160290-99160312 TCTCAGCCTCTGAAGCAGCTGGG - Intronic
935549707 2:104439668-104439690 TCTCACAAACTTAAGCAGAAGGG - Intergenic
936019913 2:108987084-108987106 GCTGAGCCACTTAAGCAGCAAGG + Intronic
936479844 2:112876221-112876243 CCTCAGCCTCTCAAGCAGCAGGG - Intergenic
937684307 2:124679026-124679048 TTTCAGGCAGGAAAGCAGAAAGG + Intronic
938999472 2:136717430-136717452 TCTCTGCCAATAAAGCATGATGG - Intergenic
940094725 2:149961784-149961806 TCTCAGCAAATCAAACAGAATGG - Intergenic
941448655 2:165632391-165632413 TCTCAGCCTCTCAAGTAGATGGG - Intronic
941919713 2:170837942-170837964 TCTCAGCCAGAAAACCTGAAGGG + Intronic
943338779 2:186651692-186651714 ATTCAGTCACTAAAGCAGAATGG - Intronic
944304876 2:198167942-198167964 GCTCAAGCACTAAAGCAGAAGGG + Intronic
945244279 2:207703632-207703654 TCTCAGCCTCTCAAGTAGCAGGG - Intergenic
948047969 2:234958113-234958135 TCTCAGATATTAAAGCAGAGGGG + Intronic
1168844035 20:930212-930234 TCTCAGCCACGCAAGCAGCTGGG + Intergenic
1170883039 20:20314272-20314294 CCTCAGCCACTAAAGTAGCTAGG - Intronic
1172325061 20:34028168-34028190 TCTCAGCCACTCAAGTAGCTAGG - Intronic
1173101266 20:40091116-40091138 TCACAGGCACATAAGCAGAAGGG - Intergenic
1173362400 20:42356339-42356361 TGTCAGCAACTAAAAGAGAAGGG - Intronic
1174772576 20:53314735-53314757 CCTCAGCCTCTCAAGCAGCAGGG + Intronic
1176253259 20:64137199-64137221 TCTCAGCCTCTCAAGCAGCTGGG + Intergenic
1177309385 21:19369268-19369290 TCCCAGCCACAAGAGCAGAAAGG - Intergenic
1177569992 21:22874795-22874817 TCTCCTCCACTGAACCAGAAAGG + Intergenic
1177608584 21:23415860-23415882 TCTCAGTAACTAATACAGAAAGG - Intergenic
1182624080 22:31633392-31633414 TCTAAGCCTCTAAGGCAGATGGG + Intronic
1183916317 22:41122918-41122940 TCTCAGCCTCCCAAGCAGATGGG - Intronic
949097043 3:98459-98481 TATCACCCATTAACGCAGAAGGG + Intergenic
949683585 3:6542686-6542708 TCAGATCCACTAATGCAGAATGG - Intergenic
949735783 3:7170221-7170243 TCTTAGCCATTTAAGTAGAATGG + Intronic
951009163 3:17656363-17656385 CCTCAGCAACTAAGGCAGAAGGG - Intronic
951045775 3:18036727-18036749 TCTCAGCAACTAAAGCAAAAAGG - Intronic
952871757 3:37906802-37906824 TCTTAGTCACAAAGGCAGAAAGG - Intronic
953113869 3:39971790-39971812 TCTCATCCACGAAGACAGAACGG - Intronic
954222255 3:49162044-49162066 TCTCTGCCACGAGAGCAGAGTGG + Intergenic
955412249 3:58663242-58663264 ACTTAGCCACTCCAGCAGAAAGG - Intronic
955960596 3:64337379-64337401 TCTCTGCCACTGGGGCAGAATGG - Intronic
956474936 3:69609933-69609955 TCCCAGCCACTCCAGCTGAAAGG + Intergenic
957106394 3:75894248-75894270 TCTCTGCCACAAAAGCTGGATGG - Intergenic
961693066 3:128684443-128684465 TCTCAGCCTCTAAAGTAGCTGGG + Intergenic
962154327 3:132929428-132929450 TTTCAGCCACAATAGCACAAGGG - Intergenic
962788568 3:138790169-138790191 TCTCAGGGACTAAAGAAGAGGGG + Intronic
962795396 3:138845457-138845479 CCTCAGCCACTGAAGCAGCCGGG + Intergenic
964798972 3:160532435-160532457 TCTCAGCAACTAAAGAGAAATGG + Intronic
966577037 3:181513421-181513443 TTGCAACAACTAAAGCAGAAAGG + Intergenic
966947451 3:184787002-184787024 TCTCAGCCACGGAGGCAGAATGG + Intergenic
967022055 3:185531428-185531450 TCTCAGCCTCTCAAGCAGCTGGG - Intronic
967837483 3:193977081-193977103 TCTCATCCCCTAAATCAGGATGG + Intergenic
968021434 3:195394145-195394167 CCTCAACCACTCAAGCTGAATGG + Intronic
969080997 4:4617908-4617930 CCTAAGGCTCTAAAGCAGAATGG + Intergenic
969323811 4:6429046-6429068 CCTCTGCCATTATAGCAGAAAGG + Intronic
969349042 4:6587467-6587489 TCACAGGGACTAGAGCAGAATGG + Intronic
971013995 4:22468651-22468673 TCTCAGCCACCCAAGCAGCTGGG - Intronic
973213539 4:47643081-47643103 TGTCAGCCACTGAAGCTGAATGG - Intronic
975099248 4:70493461-70493483 TCTAACCCACTAAAACAAAAAGG + Intergenic
975827563 4:78335786-78335808 TCTCTGTCACTAAAACATAAAGG - Intronic
976400118 4:84597521-84597543 CCTCAGCCACTCAAGCAGCTGGG - Intronic
976543617 4:86307297-86307319 TCTCAGGTACAAAATCAGAAAGG - Intronic
976656323 4:87492300-87492322 TCTCAGCCACTCAAGTAGGTGGG - Intronic
977925525 4:102696108-102696130 TCTCAGCCACTGAAGTAGCTGGG - Intronic
979030978 4:115646751-115646773 TCTCAGCCTCTGAAGTAGATGGG + Intergenic
979725117 4:123951917-123951939 TCTCAGCAACTAATGCACACTGG + Intergenic
982250421 4:153400594-153400616 TCTCAGCCTCTCAAGTAGAAAGG - Intronic
982642341 4:157978926-157978948 TCTCAGCCACTAGAGGGCAATGG - Intergenic
982703825 4:158686224-158686246 TCTGAGCCCCAATAGCAGAAAGG + Intronic
983070312 4:163259963-163259985 TCTCAGCCTCCAAAGCAGCTGGG - Intergenic
983930715 4:173450452-173450474 TCTGAGCCACTAGCACAGAAAGG - Intergenic
984041078 4:174734461-174734483 TCTCAGTTACTAAAGCAACAGGG + Intronic
985258901 4:188096770-188096792 CCTCAGCCACTCAAGTAGCAGGG + Intronic
987645522 5:20667099-20667121 TCCCATCAACTAAAGTAGAAGGG - Intergenic
987783132 5:22464884-22464906 TCTCAGCCACCAAAGTAGCTGGG - Intronic
987784716 5:22485295-22485317 TCTCAGCCTCCAGAGCAGTAGGG + Intronic
987828853 5:23069598-23069620 TCTCTGGAACTAAAGCAAAAGGG + Intergenic
988740269 5:34062860-34062882 TCTAAGTCAAAAAAGCAGAAAGG - Intronic
989696992 5:44213062-44213084 TTTCAGCCTCCTAAGCAGAAGGG + Intergenic
990330718 5:54722851-54722873 CCTCAGCCACTCAAGCAGCTGGG + Intergenic
991732547 5:69603646-69603668 TCTCATTCACAGAAGCAGAAGGG - Intergenic
991808980 5:70458790-70458812 TCTCATTCACAGAAGCAGAAGGG - Intergenic
991862406 5:71024206-71024228 TCTCATTCACAGAAGCAGAAGGG + Intronic
992411809 5:76512417-76512439 GTTTAGCTACTAAAGCAGAAAGG - Intronic
992901531 5:81301706-81301728 TCTCAGCCACCAAAGCTGCAGGG + Exonic
996314834 5:122150104-122150126 ACAGAGCCAATAAAGCAGAATGG + Intronic
996425793 5:123312663-123312685 TCTCAGCCAGTCAAGAGGAATGG + Intergenic
996552951 5:124748821-124748843 TCTCAGCCTCTATACCTGAAAGG + Intergenic
997594732 5:135099365-135099387 TCTCAGCCTCAGAAGTAGAATGG + Intronic
998588374 5:143452098-143452120 TCTCAGGCATTGAAGCAGAATGG + Intergenic
998703341 5:144731033-144731055 CCTCAGCCAGTTCAGCAGAAAGG + Intergenic
998733224 5:145105283-145105305 ACTCAGCCATAAAAGTAGAAAGG - Intergenic
998888007 5:146714897-146714919 TCTCAGCTTCAAAAGGAGAAGGG - Intronic
1003281832 6:4699683-4699705 CCTCATTCATTAAAGCAGAAAGG - Intergenic
1003650828 6:7958723-7958745 TCTCAGCCACTGAGGCTGACAGG - Intronic
1004765585 6:18722780-18722802 CCTCAGCCACTAGAGCAGCTGGG - Intergenic
1005287975 6:24349443-24349465 TCACATTCAGTAAAGCAGAAGGG + Intronic
1008712309 6:54242629-54242651 TCTCAGCCTTTGAAGCAGTAGGG - Intronic
1011916036 6:92508310-92508332 TCTCACCCAGTAAAGAGGAATGG - Intergenic
1012147312 6:95701544-95701566 TTTCAACAACTACAGCAGAAAGG - Intergenic
1013262750 6:108462286-108462308 TCTCAGCCTCTCAAGCAGCTGGG - Intronic
1013296476 6:108762152-108762174 CCTCAGCCTCTCAAGCAGATGGG - Intergenic
1013547992 6:111178640-111178662 TTTCAGCCACAAAAGAAAAAAGG - Intronic
1014226784 6:118857339-118857361 TACCAGTCAATAAAGCAGAATGG + Intronic
1014726614 6:124978908-124978930 ACTCAGCCACACAGGCAGAAAGG - Intronic
1016700188 6:147045509-147045531 CCTCAGCCTCTAAAGTAGACGGG + Intergenic
1016828916 6:148414327-148414349 TCTTAGGCAGTCAAGCAGAATGG + Intronic
1016841777 6:148532733-148532755 TCCCACCCAGCAAAGCAGAAAGG - Intronic
1017815490 6:158013263-158013285 CCTCAGCCACTCAAGCAGCTGGG - Intronic
1017983355 6:159421868-159421890 TCCCAGGCACAGAAGCAGAAAGG + Intergenic
1018238393 6:161748793-161748815 TCTCAACAGCTAAAGCATAAGGG - Intronic
1018723583 6:166592536-166592558 TATCAGGCATTACAGCAGAATGG - Intronic
1019363967 7:621803-621825 TCTCAGCCTCTAAAGCAGCAGGG + Intronic
1022495684 7:30851729-30851751 ACACAGCCACTAAAGGAGCACGG + Intronic
1024455497 7:49601201-49601223 TCTCAGCCTCTTAAGCAGCTAGG + Intergenic
1024851921 7:53728698-53728720 TCTCACCCACACAAGCAGGATGG - Intergenic
1025855746 7:65276190-65276212 TCTCAGCCACCAAAGTAGCTGGG + Intergenic
1026041297 7:66870408-66870430 CCTCAGCCACTCAAGTAGTAGGG + Intergenic
1027974797 7:85138402-85138424 TCTCAGCCTCTAGAGCAGCTGGG + Intronic
1028176388 7:87664625-87664647 GATGAGCCTCTAAAGCAGAATGG + Intronic
1030106462 7:105991520-105991542 TCTCAACAACTTATGCAGAAAGG - Intronic
1031817040 7:126450768-126450790 GCTCAGCCAGCAAAGCTGAATGG - Intronic
1031880884 7:127196984-127197006 TCTCAGCCTCTCAAGCAGCTGGG + Intronic
1032325859 7:130927612-130927634 ACTCAGCGAGAAAAGCAGAAAGG + Intergenic
1035484437 7:159211707-159211729 TCTCAGCAACTCCGGCAGAAAGG - Intergenic
1036140381 8:6202075-6202097 TCTCAGCCTCTAAAACAGTAGGG + Intergenic
1036395832 8:8370582-8370604 TGTCATCCATTATAGCAGAAAGG + Intronic
1037536361 8:19828093-19828115 TCTCAGCCTCTGAAGCAGTTGGG - Intronic
1037711990 8:21362219-21362241 TCTCAGCCACCAAAGCAAAGAGG - Intergenic
1039415696 8:37392223-37392245 CCTCACCCACTAAGGCAGGATGG - Intergenic
1041847565 8:62348985-62349007 ACACAGCCACTTAAGCAGAAGGG - Intronic
1042184014 8:66119243-66119265 GCTCAGCCTCTAAGGTAGAAAGG - Intergenic
1042361652 8:67890615-67890637 TCTCAGCCACTGAAGTAGCTAGG + Intergenic
1042904814 8:73762021-73762043 TCTCAGCCTCCCAAGCAGATAGG + Intronic
1043611860 8:82074357-82074379 AGTCAGCCATTAAAACAGAATGG + Intergenic
1044221918 8:89679047-89679069 TCTCACCCAGTAAAGAATAATGG - Intergenic
1047163691 8:122411872-122411894 TCTCAGCCTCTAAAGTAGCTGGG + Intergenic
1048913272 8:139157173-139157195 TCTCAGGAAATAAAGCAGCATGG - Intergenic
1049077866 8:140414416-140414438 TCTCAGCCTCTAAAGTAGCTGGG - Intronic
1049588804 8:143445575-143445597 CCTCAGCCTCTCAAGCAGCAGGG - Intronic
1050165564 9:2761261-2761283 TCTGAGACACTGAAGCAGTATGG - Intronic
1052278219 9:26702754-26702776 TCTAAACCACTTAAGAAGAATGG - Intergenic
1052702969 9:31960124-31960146 TCCCACCCAGTAAGGCAGAATGG - Intergenic
1053136260 9:35652009-35652031 TCTCAGCCACCTAAGCAGCTAGG + Intergenic
1053455173 9:38227924-38227946 TCTCAGCAGCTCAAGGAGAAAGG - Intergenic
1056553385 9:87669901-87669923 TCTCAGAATCCAAAGCAGAAGGG - Intronic
1056889048 9:90472145-90472167 TCTCAGCCTCTCAAGTAGATGGG - Intergenic
1058770483 9:108226498-108226520 TCTCAGAGACTAAGGCAGAAGGG + Intergenic
1059170943 9:112123982-112124004 TCTCAGACAGTCAAGCAGAGGGG + Intronic
1059332905 9:113547486-113547508 ACTCAGCCACCTGAGCAGAAAGG - Intronic
1060322250 9:122573209-122573231 CCTCAGCAAAGAAAGCAGAATGG + Intergenic
1061630288 9:131867936-131867958 TCCCAGGCACTACAGGAGAATGG + Intronic
1061671172 9:132188960-132188982 CCTCAGCCACTAACATAGAATGG - Intronic
1186003491 X:5041480-5041502 TCTCAGCCACCTAAGCAGCTGGG + Intergenic
1186958493 X:14709117-14709139 TCTCAGCCACTCAAGTAGCAGGG - Intronic
1187469279 X:19553663-19553685 CCTCAACCAGTAAAACAGAATGG - Intronic
1188494137 X:30765876-30765898 TCCCAGCTACTAAAGGAGAAAGG - Intergenic
1190103730 X:47543372-47543394 TCTCAGCCTCCAAAGCAGCTAGG - Intergenic
1191668998 X:63731673-63731695 CCTCAGCCTCTAAAGCAGCTGGG + Intronic
1193469568 X:81883188-81883210 TCATAGCCACCAAAGCAGCATGG - Intergenic
1193758725 X:85440246-85440268 TCTCACCCAGTCAGGCAGAATGG + Intergenic
1194037217 X:88890378-88890400 TTTCCACCACCAAAGCAGAAAGG + Intergenic
1194973698 X:100372119-100372141 TCTCAGCCTCTCAAGCAGCTGGG - Intronic
1195292559 X:103443188-103443210 TCTCAGCCTCCCAAGCAGATGGG - Intergenic
1196088866 X:111717051-111717073 TCTCAGCTACTACAGCAGGAGGG - Intronic
1196898501 X:120361143-120361165 TCTCAGCCACTTGAGTATAATGG + Intergenic
1197563775 X:128055807-128055829 GCTCAGCTCCTACAGCAGAAGGG - Intergenic
1198599067 X:138265487-138265509 TCTCAGCCACCAACTTAGAAAGG - Intergenic
1200087282 X:153613441-153613463 TCTCAGCCACAAAAGGATCACGG + Intergenic
1200448210 Y:3290810-3290832 TCTCAGCCTCCAAAGCAGCTGGG - Intergenic
1200492096 Y:3839280-3839302 TCTCAGCCACCCAAGCAGCTGGG - Intergenic
1201233963 Y:11892427-11892449 TCTCAGCCCATATAACAGAATGG + Intergenic