ID: 1120144010

View in Genome Browser
Species Human (GRCh38)
Location 14:80959480-80959502
Sequence CTCTGAATAAGGAGGTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120144004_1120144010 14 Left 1120144004 14:80959443-80959465 CCATTTGTTGCCTCTGTGCATGA 0: 1
1: 0
2: 1
3: 14
4: 250
Right 1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG 0: 1
1: 0
2: 1
3: 24
4: 231
1120144005_1120144010 4 Left 1120144005 14:80959453-80959475 CCTCTGTGCATGAGAAGATCCTT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG 0: 1
1: 0
2: 1
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120144010 Original CRISPR CTCTGAATAAGGAGGTAGAA AGG Intronic
902174835 1:14641238-14641260 ATCAAAATAAGGAGGTAGACTGG + Intronic
902309852 1:15573806-15573828 CTCTGGAAAAGGAGGCACAAGGG - Intronic
902879540 1:19362158-19362180 CTCTGGTCAAGGAGGTAGAAGGG + Intronic
904221430 1:28973196-28973218 CTCTGACTAGGGAAGTAAAAGGG + Intronic
904551135 1:31319347-31319369 CTCTGACTCAGGAGGAAGACTGG + Intronic
904680292 1:32224285-32224307 TTCTGGATAAGGAGGTAAGAGGG + Intronic
904995718 1:34629829-34629851 TTCACAATAAGGAGGTAGGAGGG - Intergenic
907647626 1:56260009-56260031 TTATGAATAAGGAAATAGAAAGG - Intergenic
908635316 1:66157343-66157365 CACTGCAAAAGGAGCTAGAAAGG - Intronic
911269113 1:95778996-95779018 CTGTGAATAATGAGTTAGAAAGG - Intergenic
911844002 1:102725505-102725527 CTCTGAAAATGGAGGTATAATGG - Intergenic
912079023 1:105912393-105912415 TACTGAATCAGGAGATAGAATGG - Intergenic
913581361 1:120230527-120230549 CTCTTAAAAAAGAGGTTGAAAGG - Intergenic
913626815 1:120667864-120667886 CTCTTAAAAAAGAGGTTGAAAGG + Intergenic
914563293 1:148841970-148841992 CTCTTAAAAAAGAGGTTGAAAGG - Intronic
914609534 1:149288253-149288275 CTCTTAAAAAAGAGGTTGAAAGG + Intergenic
915846164 1:159267564-159267586 CTCTGAGAAAGGAGGAAGTAAGG - Intergenic
917036155 1:170749310-170749332 CTCTAGATAAGCAGGGAGAAGGG + Intergenic
918128520 1:181604966-181604988 CTCTGAGTCAGGAGGAGGAACGG + Intronic
918333449 1:183482887-183482909 CTTGAGATAAGGAGGTAGAATGG + Intronic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920741134 1:208582272-208582294 GTCTGAACAAAGAGGTACAAAGG - Intergenic
921798467 1:219374947-219374969 TGCTGAATAAGGAGATGGAAGGG - Intergenic
924290484 1:242531219-242531241 CACTGAATCAGGAGGGAGGAGGG - Intergenic
1064793396 10:18984958-18984980 CTTTAAATAAGGAGGAGGAAAGG - Intergenic
1067460536 10:46454980-46455002 CACTGAGGAAGGAGGTAGCAGGG + Intergenic
1067626656 10:47929623-47929645 CACTGAGGAAGGAGGTAGCAGGG - Intergenic
1070705976 10:78638918-78638940 CTCTGAATCAACAGGCAGAAGGG - Intergenic
1071849030 10:89549927-89549949 CTCTGCTTAAAGAGGGAGAAAGG - Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1073082163 10:100867106-100867128 TGCTGAGGAAGGAGGTAGAAAGG - Intergenic
1074134881 10:110617614-110617636 CACTGAAGTGGGAGGTAGAAGGG + Intergenic
1074145790 10:110716182-110716204 CTAGTAATGAGGAGGTAGAATGG + Intronic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074933078 10:118148900-118148922 TTCTAATTAAGGAGTTAGAATGG - Intergenic
1075402487 10:122171190-122171212 TTCTGAATAAGGAGGCAGACAGG - Intronic
1075578661 10:123599446-123599468 CTCTGAATGATGAGTTAGAGAGG - Intergenic
1076322579 10:129594318-129594340 TTCTGAACAAGGAGGTAGCCTGG + Intronic
1078088740 11:8250923-8250945 GTCTCAATTAGGAGGTAGAGGGG - Intronic
1078131399 11:8617061-8617083 CTCTGAATGAGGATGATGAAGGG + Exonic
1078192308 11:9101347-9101369 CTCTCCATAAGGTGGGAGAAAGG + Intronic
1078902833 11:15657389-15657411 TTCTGAACCAGGAGGTGGAACGG - Intergenic
1079004282 11:16781302-16781324 CCCTGAGTAGGGAGGAAGAAAGG + Intronic
1081882514 11:46465702-46465724 ATCAGTGTAAGGAGGTAGAAAGG + Intronic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1085185156 11:74569829-74569851 CACAGGAGAAGGAGGTAGAAGGG - Intronic
1085420916 11:76358825-76358847 CTCTGAATATGGGAGTAGAAGGG + Intronic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1088822972 11:113472309-113472331 CTCTGAATAAACAAGTATAAGGG - Intronic
1088980644 11:114860040-114860062 CTTTGAAGATGGAGGAAGAAGGG + Intergenic
1091944820 12:4529385-4529407 TTCTGAATAGGGAGACAGAATGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092836390 12:12493087-12493109 CCCTGAAGGAGGAGGTATAAAGG - Intronic
1095509460 12:42934511-42934533 ATCTGTATAAGCAGGTGGAAAGG + Intergenic
1095838030 12:46659912-46659934 GACTAAATAAGGAAGTAGAAAGG - Intergenic
1096839832 12:54373499-54373521 CTCTGACTAGGGAGGTCAAAAGG + Intronic
1098848122 12:75562833-75562855 ATTTTAATAAGGAGGTTGAAAGG - Intergenic
1099078145 12:78138373-78138395 CTTTAAATAAGAAGGTAGGAAGG - Intronic
1099957812 12:89368334-89368356 TTCTAAATAAGAAGGAAGAATGG - Intergenic
1101842156 12:108335577-108335599 CTGTAAATAAGGAGGTCGAATGG - Intronic
1106944529 13:34811852-34811874 ATCAGAATCAGGAGGAAGAATGG - Intergenic
1107858535 13:44638834-44638856 CTATTAGTAAGGAGGAAGAAGGG + Intergenic
1108129675 13:47284630-47284652 CACAGAATAGGGAGGCAGAATGG + Intergenic
1108385213 13:49893524-49893546 CACTGAATAGGGAGGCAGTATGG + Intergenic
1108847773 13:54697022-54697044 GACTGAATCAGGAGATAGAAAGG + Intergenic
1109215751 13:59587894-59587916 CTTTGAAGCAGGAGGTAGGATGG - Intergenic
1109756413 13:66766587-66766609 ATAAGAATAAGGAGGTGGAAGGG + Intronic
1109862060 13:68212664-68212686 CTTTGAATCAGGAGGTTAAATGG - Intergenic
1110075756 13:71240085-71240107 TTCTGAAAAAGCACGTAGAAAGG - Intergenic
1111281637 13:86032822-86032844 CTTATAATAAGGAGGTAGAAAGG - Intergenic
1111792058 13:92870264-92870286 CTCTGTGCAAGGAGGCAGAAAGG - Intronic
1112534213 13:100234596-100234618 CCCTGAATAAGGAGGTTGGCAGG - Intronic
1112605233 13:100897878-100897900 TTCTGAATTATGAGTTAGAAAGG - Intergenic
1113466960 13:110519736-110519758 CTCTGAAGAAGGAAGAAGAGTGG - Intergenic
1114575770 14:23711587-23711609 ATCTGAATAAGGAGGGAATAAGG + Intergenic
1114844181 14:26301089-26301111 CTCTGATAAAAGAGGTTGAATGG + Intergenic
1114891375 14:26928293-26928315 CTGTAATTTAGGAGGTAGAAGGG + Intergenic
1115292490 14:31788268-31788290 CTCTGAAAGAGGAGGCAGAATGG + Intronic
1115347170 14:32355333-32355355 CTAAGAATAATGAGGTAGAGAGG - Intronic
1117594003 14:57307773-57307795 CTCTGATTCAGGGGGTTGAATGG - Intergenic
1118327687 14:64792650-64792672 CTCTGGAGAAGGAGGTTGAGAGG - Intronic
1120114502 14:80597914-80597936 CTCAGAAAAAGGAACTAGAAGGG + Intronic
1120122020 14:80692571-80692593 CACTGACTAAGGAGATATAATGG - Intronic
1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG + Intronic
1120330208 14:83082805-83082827 CTCTGAATACTAAGGTAGAGAGG - Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1125605155 15:40936116-40936138 CTCTGCAGGTGGAGGTAGAAGGG + Intronic
1126976476 15:54187565-54187587 CTATGCAAAGGGAGGTAGAAAGG - Intronic
1127235246 15:57042936-57042958 CTCAGAAGCAGAAGGTAGAATGG - Intronic
1127600798 15:60534589-60534611 CTCTCGGTAAGGTGGTAGAAGGG + Intronic
1127737171 15:61853088-61853110 CTCTGATCAAGGATGGAGAAAGG + Exonic
1129770730 15:78201730-78201752 CTCTGGACAATGAGTTAGAAGGG + Intronic
1133035105 16:3029977-3029999 TACTGAATGAGGAGGTAGACTGG - Intronic
1135408248 16:22213832-22213854 CTTATAAAAAGGAGGTAGAAGGG - Intronic
1135638802 16:24102047-24102069 CCCTGTATCAGGAGGCAGAATGG - Intronic
1138354173 16:56364546-56364568 CTCTGAAAACAGAGGTAAAAAGG + Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1141390703 16:83660722-83660744 ATCTGAATCTGGAGGAAGAATGG - Intronic
1141777825 16:86135984-86136006 CTCTGAAAAAGGAGGTCGCTAGG + Intergenic
1142642507 17:1292552-1292574 CGCTGACTGAGGAGGTAGGAGGG - Intronic
1142705836 17:1693665-1693687 TTCTGAATAAGGAAGGAGCATGG + Intergenic
1143822059 17:9572740-9572762 CGCTGATTAGGGGGGTAGAAAGG - Intronic
1144353556 17:14422851-14422873 CTCAGAAGCAGGAAGTAGAATGG + Intergenic
1144726259 17:17504164-17504186 CTCTGCATATGGAGGTAGAGTGG - Intergenic
1145951227 17:28819226-28819248 CTATGAATAAGAAGTGAGAAGGG - Intronic
1151965373 17:77428441-77428463 TTCTGGATAAGGAAGTTGAAAGG - Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1154382783 18:13867778-13867800 CTCTGAATACGAAGTTTGAAGGG - Intergenic
1155840438 18:30636031-30636053 CTCTGAATAATGAGGTAGACTGG - Intergenic
1155976487 18:32137341-32137363 TCCTGCATAAGGAGGTACAATGG - Intronic
1156921033 18:42522583-42522605 CTCAGAAGAAGGAGGCAGGAAGG + Intergenic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1157775612 18:50393647-50393669 CTCTGAACAAGGAACTAGATAGG - Exonic
1158332761 18:56380844-56380866 CACTGAAGCAGGAAGTAGAATGG + Intergenic
1159382441 18:67678696-67678718 CTCTGGTTAAAGAGGTAGATTGG - Intergenic
1160311162 18:77791593-77791615 CAATGAACAAGGAGGCAGAATGG - Intergenic
1164191189 19:22918687-22918709 CTCTGAATAGGGAGTAAGCAGGG - Intergenic
924972506 2:141836-141858 CGCTGGAGAAGGAGGAAGAAAGG + Intergenic
926551997 2:14312136-14312158 CTCTGAATTAGAAGGTAGAGGGG + Intergenic
927013190 2:18927843-18927865 TTCTGAAAAGGAAGGTAGAATGG - Intergenic
928844157 2:35648965-35648987 CCCAGAAAAAGGAGGAAGAAAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931473737 2:62566949-62566971 CTCTGAACAAGGAGTTATAATGG + Intergenic
933572009 2:84025093-84025115 CTCTGAAGATGGAGGAAGGAGGG + Intergenic
936386231 2:112032051-112032073 CTCAGGATCAGGAGGTCGAAAGG + Intergenic
938930260 2:136080690-136080712 CTCTAAATGATTAGGTAGAAAGG - Intergenic
939549284 2:143593629-143593651 ATCTGAATAAGGAGTTTAAATGG + Intronic
940300420 2:152171149-152171171 CTCGGAGAAAGGAGGAAGAATGG + Intronic
940448752 2:153811685-153811707 CTCTAAATAAGGAGCCACAAGGG - Intergenic
940721837 2:157290989-157291011 CTGTGAATGAGGAGGTTGAGAGG + Intronic
941012977 2:160322304-160322326 CTCTGAGTATGGAAGAAGAAGGG + Intronic
942134834 2:172914540-172914562 CACTGAATATGGAGGAAGAGAGG + Intronic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
944156479 2:196612489-196612511 CTCTGAATATGAAGGGGGAAGGG + Intergenic
944803901 2:203262123-203262145 CTCAGTATAAGGTGCTAGAAAGG - Intronic
945334072 2:208571061-208571083 CTCTGAAAGACGAGGTAGAGCGG + Intronic
948193937 2:236081032-236081054 GTCAGAATAATGTGGTAGAAGGG - Intronic
1169630733 20:7627827-7627849 CTATGGCTAAGAAGGTAGAACGG + Intergenic
1170259521 20:14388357-14388379 CTCTGAATAATGTGGTAGTTGGG + Intronic
1171481817 20:25460338-25460360 CTCTAAATCACGAGGAAGAAGGG + Intronic
1172755892 20:37284084-37284106 CTCCGAATCTGGAGGTAGAAAGG - Intergenic
1174960058 20:55146034-55146056 GTCTGTAAAAGGAGGCAGAATGG + Intergenic
1175857308 20:62129046-62129068 CTCTGAATCAGGAGGAAAATGGG - Intronic
1181853982 22:25769325-25769347 CTCTGGAGAAGGATGCAGAAAGG + Exonic
1182071623 22:27467626-27467648 CTCTGAATAGGGATGAAGAACGG - Intergenic
1182923290 22:34099611-34099633 CACTAAAAAAGAAGGTAGAATGG + Intergenic
949195871 3:1306781-1306803 CTTTGACTGAGGAGGTAAAAAGG + Intronic
950168240 3:10817299-10817321 CTCTGCATAGAGATGTAGAAGGG + Intronic
950645657 3:14375058-14375080 CTGAGAATTAGGAGCTAGAATGG - Intergenic
953589381 3:44236867-44236889 CACTGAATAAGGAGAAAGGAGGG - Intergenic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
956200580 3:66701482-66701504 CTCTAAATGATAAGGTAGAAAGG - Intergenic
956994383 3:74807358-74807380 TTCTCAAGAAGGTGGTAGAAAGG + Intergenic
959098797 3:101986978-101987000 CTTGGAATAAGGAGGAAGAAAGG + Intergenic
963871505 3:150420205-150420227 CACTGATCAAGGAAGTAGAAGGG - Intronic
964343033 3:155728706-155728728 ATGAGAATAGGGAGGTAGAAAGG - Intronic
965014102 3:163133080-163133102 TTCTGAATAATGATGGAGAAAGG + Intergenic
965259893 3:166468417-166468439 CTCTGAATCAAGAGGCAAAAAGG + Intergenic
966197359 3:177326619-177326641 CTCTCAATAATCAGGTAGGAAGG - Intergenic
967442828 3:189528591-189528613 CTATGAATAAGGAGCTAGACTGG - Intergenic
969660842 4:8526571-8526593 CGCTGAATAAGGAGGCTGGAGGG - Intergenic
970208377 4:13679933-13679955 CTCTGGATATGGAGATGGAAAGG + Intergenic
971059265 4:22949092-22949114 CTGAGTATAAGGAGGTAAAAAGG - Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
972969847 4:44559896-44559918 CTCTGATTTAGTAGGTAGAGTGG + Intergenic
973074803 4:45910365-45910387 ATCTGAATAATGGGGGAGAATGG + Intergenic
976904182 4:90216057-90216079 ATTTGAATAAGTTGGTAGAAAGG + Intronic
977289414 4:95147585-95147607 TTGGGAATCAGGAGGTAGAAAGG + Intronic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
981471577 4:145141407-145141429 CAGTGAATAAGGTGGTACAATGG + Exonic
981895436 4:149793894-149793916 GTGTGATTTAGGAGGTAGAAAGG - Intergenic
982065435 4:151650383-151650405 TTCTCACTAAGGAGGAAGAAGGG + Exonic
982798446 4:159673068-159673090 GACTGAATCAGGAGATAGAAAGG - Intergenic
984617089 4:181910893-181910915 CTATGAAAAGGGAGCTAGAATGG - Intergenic
984697614 4:182795185-182795207 TGCTGAATCAGGAGGCAGAAAGG - Intronic
986598795 5:9450500-9450522 CTATGATTATGGAGGGAGAATGG - Intronic
988088548 5:26504110-26504132 CTCTGAAGAATGCGGTGGAAAGG + Intergenic
990014494 5:51043150-51043172 TTCTGAGTAAGGAGTTTGAACGG + Intergenic
990649838 5:57885884-57885906 CTCTTTTTAAGGAGGGAGAAGGG - Intergenic
991100105 5:62782539-62782561 CTAAGAATAATGAGGTACAAAGG + Intergenic
991377952 5:65985882-65985904 CTGTTAATAAGGACTTAGAATGG - Intronic
991574456 5:68088372-68088394 CTCTGAAAAAGGAGGTCATATGG - Intergenic
992540552 5:77760053-77760075 CTCTGATTAAGGAGGATAAAAGG - Intronic
992594110 5:78328162-78328184 CTTTGAATAAGAGGGAAGAAAGG + Intergenic
992594128 5:78328366-78328388 CTTTGAATAAGAGGGAAGAAAGG - Intergenic
992656516 5:78915567-78915589 GTATGAATAAGAAGGTAAAATGG + Intronic
993458928 5:88159264-88159286 ATCTGGAAAAGGAGATAGAATGG + Intergenic
995495930 5:112743217-112743239 CTTTTAAGAAGGAGGCAGAAGGG - Intronic
995684039 5:114751388-114751410 CTCTAAGCAAGGAGGTTGAAAGG - Intergenic
996253779 5:121372568-121372590 ATCTGAATAAGGAAGAAGAGAGG - Intergenic
998286964 5:140871436-140871458 GTCTGAATAAAGAGGAGGAAGGG + Exonic
1000098795 5:157994721-157994743 GTCTGAATGAGCAGGCAGAAGGG + Intergenic
1002348553 5:178565439-178565461 CTCTTCGTAAGCAGGTAGAAGGG - Intronic
1003088073 6:3077416-3077438 CTCTGACAAAGGAGGGAGAGAGG - Intronic
1004590655 6:17048057-17048079 TTCTGATTAATGAGGTAGCAGGG - Intergenic
1005851442 6:29825992-29826014 CTCTGAAGACTGAGGTAGGAGGG + Intergenic
1006270373 6:32960866-32960888 CTCTGAAACAGGAGGTGGCAGGG - Intronic
1007285660 6:40745573-40745595 CTTTGATTAAGGAGGTTTAAGGG - Intergenic
1007977244 6:46114082-46114104 CTCTGAAAGATGAGGCAGAATGG + Intergenic
1008344278 6:50407221-50407243 CACTGAATAGGGAGGAAGACAGG + Intergenic
1008726939 6:54432771-54432793 CTCTGAAGAAGGAAGCATAAAGG + Intergenic
1008864541 6:56193718-56193740 CTCTGCATAAAGAGTTATAAAGG + Intronic
1009626585 6:66144131-66144153 AGCTGAATCAGGAGGTAGAGAGG + Intergenic
1011519923 6:88194258-88194280 CTCTGGATAAGGAGGTCGGTGGG + Intergenic
1014214117 6:118736515-118736537 GTCTGAATCAGGAGGTAGGGAGG + Intergenic
1014754889 6:125292020-125292042 GCCTGAGTAAGGAAGTAGAAAGG + Intronic
1015613183 6:135047980-135048002 CCCTGAATAAGGAGCTATAAAGG + Intronic
1015731868 6:136357299-136357321 CTTTGAATAATGAGGTGGAATGG - Intronic
1015757950 6:136627204-136627226 GTGAGAATAAGGAGGTAAAATGG - Intronic
1017148464 6:151256134-151256156 CACTGAATAATGAGGCAGGAAGG + Intronic
1017748492 6:157468297-157468319 CTCTGAACGCGGAGGTAGCAGGG + Intronic
1020921656 7:14272849-14272871 TTCTGAATAATGAGTTTGAAAGG + Intronic
1024085199 7:45887047-45887069 TTCTGAAGCTGGAGGTAGAATGG - Intergenic
1024347858 7:48331045-48331067 GTCTGAATAAGGAGGGAAGAGGG + Intronic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1028101961 7:86831616-86831638 CTCAGACTAAGAAGGAAGAATGG - Intronic
1028400109 7:90416352-90416374 CTCAGAAAAAGGAACTAGAAAGG + Intronic
1029593008 7:101519732-101519754 CTCAGAATGACGAGGTTGAACGG - Intronic
1031200113 7:118671538-118671560 CTCTGAAAAAGAAGGTAAAGGGG - Intergenic
1032536686 7:132670246-132670268 CCCTGTACAAGGAGGAAGAATGG + Intronic
1032733059 7:134663627-134663649 CTCTGAAAAAGGAGTTGGCACGG - Intronic
1033024523 7:137759640-137759662 CTATCAATAAGAATGTAGAAGGG - Intronic
1033183569 7:139204192-139204214 CTTTGAAGACGGAGGAAGAAAGG + Intergenic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1036590533 8:10163934-10163956 CTCAGAATATGGAGACAGAAAGG - Intronic
1041935220 8:63325530-63325552 AACTGAATCAGGAGATAGAAAGG - Intergenic
1042453097 8:68972562-68972584 CTCTCACTAAGGAAGTGGAATGG - Intergenic
1043834148 8:85027440-85027462 CCTTGAATAAGCAGGTAAAATGG - Intergenic
1044348267 8:91132390-91132412 TTATGAATAAGGAAGCAGAAGGG - Intronic
1048350878 8:133615045-133615067 CTCTGAATAACTAAGTACAAGGG - Intergenic
1049346258 8:142140586-142140608 CTCTGAAGAAGGGAGGAGAAGGG + Intergenic
1052375923 9:27717425-27717447 TTATGAATGAGGAGGTTGAAGGG - Intergenic
1052548654 9:29917189-29917211 CTCTGAAAAAAGAGGTTGAAGGG - Intergenic
1052655691 9:31356601-31356623 TTCTAAATAAGGATGTACAATGG - Intergenic
1053848496 9:42266387-42266409 CTGAGAACAGGGAGGTAGAAGGG - Intergenic
1054857823 9:69919854-69919876 CTCTGAAGTAGAAGGTAGCAGGG - Intergenic
1054953136 9:70876024-70876046 CTCCAAATAAAAAGGTAGAAGGG + Intronic
1056451471 9:86721427-86721449 CTTTGACTAAGGAGGTGGAAAGG - Intergenic
1057165478 9:92921792-92921814 ATCTGAAGAAGGAGGAAGACAGG - Intergenic
1057836592 9:98450279-98450301 CTATAAATAAAGAGTTAGAAAGG - Intronic
1058654989 9:107212163-107212185 CTCTGAATAAGCACCTAGCACGG + Intergenic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059779839 9:117514811-117514833 ATATGAATAAGGAGGCACAAAGG + Intergenic
1060602443 9:124887145-124887167 CGCTGAACAAGGAGGCAGGAAGG + Intronic
1060975607 9:127763150-127763172 CCCTGAATAAAGAGGGAGGAGGG - Intronic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1189932679 X:46031634-46031656 CTCTGAGCAGGGAGGTAGATGGG - Intergenic
1194722558 X:97357384-97357406 CCCTGAATAAGGCAGTAGAAGGG + Intronic