ID: 1120149145

View in Genome Browser
Species Human (GRCh38)
Location 14:81013751-81013773
Sequence CAGACCACACATGTGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120149140_1120149145 4 Left 1120149140 14:81013724-81013746 CCATCCTCCAAAGCTCTTTCTTC 0: 1
1: 0
2: 5
3: 52
4: 558
Right 1120149145 14:81013751-81013773 CAGACCACACATGTGGCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 197
1120149142_1120149145 -3 Left 1120149142 14:81013731-81013753 CCAAAGCTCTTTCTTCATACCAG 0: 1
1: 0
2: 1
3: 17
4: 272
Right 1120149145 14:81013751-81013773 CAGACCACACATGTGGCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 197
1120149141_1120149145 0 Left 1120149141 14:81013728-81013750 CCTCCAAAGCTCTTTCTTCATAC 0: 1
1: 0
2: 1
3: 27
4: 243
Right 1120149145 14:81013751-81013773 CAGACCACACATGTGGCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 197
1120149139_1120149145 28 Left 1120149139 14:81013700-81013722 CCAGTGAGCATTAGTGCTTATAT 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1120149145 14:81013751-81013773 CAGACCACACATGTGGCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120149145 Original CRISPR CAGACCACACATGTGGCCCA AGG Intronic