ID: 1120149826

View in Genome Browser
Species Human (GRCh38)
Location 14:81020889-81020911
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120149826_1120149828 20 Left 1120149826 14:81020889-81020911 CCTATCTTTGTGAAGCAGGGTTT 0: 20
1: 32
2: 26
3: 28
4: 193
Right 1120149828 14:81020932-81020954 AATGAGATTACAGAGTAGACTGG 0: 3
1: 13
2: 27
3: 55
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120149826 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intronic