ID: 1120157947

View in Genome Browser
Species Human (GRCh38)
Location 14:81114613-81114635
Sequence ACCATTGCACAGGCGTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3190
Summary {0: 1, 1: 7, 2: 327, 3: 1824, 4: 1031}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120157947 Original CRISPR ACCATTGCACAGGCGTGCTT AGG Intronic
Too many off-targets to display for this crispr