ID: 1120161710

View in Genome Browser
Species Human (GRCh38)
Location 14:81152800-81152822
Sequence ACCATGGCATTGATTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120161710_1120161717 29 Left 1120161710 14:81152800-81152822 CCCTGAGCAATCAATGCCATGGT No data
Right 1120161717 14:81152852-81152874 TACCTGTTTTCATCATCTGCAGG No data
1120161710_1120161713 -9 Left 1120161710 14:81152800-81152822 CCCTGAGCAATCAATGCCATGGT No data
Right 1120161713 14:81152814-81152836 TGCCATGGTCTGGATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120161710 Original CRISPR ACCATGGCATTGATTGCTCA GGG (reversed) Intergenic
No off target data available for this crispr