ID: 1120161713

View in Genome Browser
Species Human (GRCh38)
Location 14:81152814-81152836
Sequence TGCCATGGTCTGGATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120161710_1120161713 -9 Left 1120161710 14:81152800-81152822 CCCTGAGCAATCAATGCCATGGT No data
Right 1120161713 14:81152814-81152836 TGCCATGGTCTGGATGAAAGAGG No data
1120161711_1120161713 -10 Left 1120161711 14:81152801-81152823 CCTGAGCAATCAATGCCATGGTC No data
Right 1120161713 14:81152814-81152836 TGCCATGGTCTGGATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120161713 Original CRISPR TGCCATGGTCTGGATGAAAG AGG Intergenic
No off target data available for this crispr