ID: 1120162814

View in Genome Browser
Species Human (GRCh38)
Location 14:81163587-81163609
Sequence GTTGATTTACTAATAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120162814_1120162815 20 Left 1120162814 14:81163587-81163609 CCTGATTTTATTAGTAAATCAAC No data
Right 1120162815 14:81163630-81163652 TTGTGTAAAGTAAGCATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120162814 Original CRISPR GTTGATTTACTAATAAAATC AGG (reversed) Intergenic
No off target data available for this crispr