ID: 1120163720

View in Genome Browser
Species Human (GRCh38)
Location 14:81171998-81172020
Sequence CATGCTCACATATTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120163713_1120163720 6 Left 1120163713 14:81171969-81171991 CCATGAGGCTGTCCAGCAATGTG No data
Right 1120163720 14:81171998-81172020 CATGCTCACATATTTAAAGTGGG No data
1120163716_1120163720 -6 Left 1120163716 14:81171981-81172003 CCAGCAATGTGGGCTCCCATGCT No data
Right 1120163720 14:81171998-81172020 CATGCTCACATATTTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120163720 Original CRISPR CATGCTCACATATTTAAAGT GGG Intergenic
No off target data available for this crispr