ID: 1120164738

View in Genome Browser
Species Human (GRCh38)
Location 14:81185226-81185248
Sequence CACAAAGGACAACCTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120164738 Original CRISPR CACAAAGGACAACCTCAAAG TGG Intronic
904836114 1:33338049-33338071 CACAAAAGACAAGGTCAGAGGGG - Intronic
905521337 1:38602942-38602964 CAGAAAGGAACACCTCACAGAGG + Intergenic
909718148 1:78735443-78735465 GACCAAAGACAACCCCAAAGAGG + Intergenic
912009659 1:104943611-104943633 CACAAAGGAAAATCACAAATGGG - Intergenic
912452180 1:109774005-109774027 CACACAGGCAAACTTCAAAGAGG - Intronic
915360739 1:155285055-155285077 GACACAGGTCAAACTCAAAGGGG - Intronic
915860043 1:159434465-159434487 CACTCAGCACAACCCCAAAGAGG + Intergenic
915959339 1:160251808-160251830 CTCAAAGGATGACCCCAAAGAGG + Intronic
916962326 1:169901707-169901729 CACATAGGAGATACTCAAAGAGG + Intergenic
916975338 1:170071547-170071569 CACAGTGGACAAGATCAAAGGGG + Intronic
918782015 1:188711631-188711653 GACAAAGGGCATCCTCAAAATGG - Intergenic
919270203 1:195331699-195331721 CACAATGGACAAAGACAAAGAGG + Intergenic
920359138 1:205400538-205400560 CACAAGGGTGAACCTCAAATTGG - Intronic
920499810 1:206479006-206479028 CACAGAGGTGACCCTCAAAGAGG - Exonic
921430706 1:215062494-215062516 AAAAAAGGGCAACCTCTAAGGGG + Intronic
922492510 1:226029513-226029535 CACAAAGGAGGACATCAAAGAGG - Intergenic
922601305 1:226856803-226856825 CACAAAGGAGAACATGAAACTGG + Intergenic
923001666 1:230011335-230011357 CACAAAGGGCAGCCTGAAAGTGG - Intergenic
923870290 1:237985580-237985602 CCCAGAAGACAACCTCAACGAGG - Intergenic
924618765 1:245641262-245641284 CACAAAGGTCAAAGGCAAAGAGG - Intronic
1065495600 10:26324472-26324494 CACTAATGTCAATCTCAAAGGGG - Intergenic
1070892700 10:79953620-79953642 CAAATAGGACAAACCCAAAGAGG - Intronic
1072824190 10:98589631-98589653 AACGAAGGACAAGCTCACAGGGG - Intronic
1073470493 10:103719184-103719206 CTCAAAGGAAAACATCAAAGGGG + Intronic
1073737768 10:106369331-106369353 CAGACAGGACAGCCTCCAAGGGG - Intergenic
1073844476 10:107538110-107538132 CACATAGGACATCCAAAAAGAGG + Intergenic
1073966961 10:109001350-109001372 AACAAAGAACAACCTTACAGAGG - Intergenic
1074572972 10:114641623-114641645 CACATAGCACGTCCTCAAAGAGG - Intronic
1075308156 10:121386440-121386462 AACAAGAGACAACCTGAAAGAGG + Intergenic
1078089315 11:8254567-8254589 CAGAGAGGAAAACCTGAAAGAGG + Intronic
1081552274 11:44124909-44124931 CAGAAAGGACACCCTCTGAGAGG - Exonic
1081691911 11:45084296-45084318 CACAGAGGATATCCTCAAAAAGG - Intergenic
1084680912 11:70665888-70665910 CACAAGAGACAAGCTCAGAGGGG - Intronic
1086300407 11:85421244-85421266 CACAAAGGACAAGCTGAAGCAGG - Intronic
1090721193 11:129474791-129474813 TGGAAAGGACAACCTCAAGGAGG + Intergenic
1090940685 11:131385387-131385409 CACAAATGAAAACCACAACGAGG + Intronic
1092506959 12:9112339-9112361 CAGACAGGACAACTTCAAAAAGG - Intronic
1092948487 12:13478447-13478469 CAAAAAGCACAACCATAAAGGGG + Intergenic
1094395236 12:29998470-29998492 CAAAGGGGACAGCCTCAAAGAGG - Intergenic
1094503024 12:31037140-31037162 CCCAGAGGACAATGTCAAAGAGG + Intergenic
1096060944 12:48699713-48699735 CACAAACCACAACCTCTAAATGG + Intronic
1099412998 12:82355008-82355030 CAAAAAGGACATCTTCAGAGAGG - Intronic
1099915646 12:88889288-88889310 CACAAAGGAAAATATCAAAATGG + Intergenic
1101468979 12:104977383-104977405 CATAAAGAAGAACCACAAAGAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103020306 12:117528587-117528609 AAGAAAGGTCAACCACAAAGTGG + Intronic
1103150398 12:118633320-118633342 CACAAAGTATAAGCTCCAAGAGG - Intergenic
1103204197 12:119115572-119115594 CTAAAAGGACAGGCTCAAAGAGG + Intronic
1104563591 12:129860444-129860466 CAGAAAAGAAATCCTCAAAGGGG + Intronic
1106044382 13:26124604-26124626 CTAAAAGCAGAACCTCAAAGAGG - Intergenic
1106194835 13:27484125-27484147 ACCAAATGACAACCTCAAAGTGG + Intergenic
1107255506 13:38421430-38421452 AGCAAATGACAACCTTAAAGTGG - Intergenic
1109649934 13:65311260-65311282 CACAGAGGACAGCCTCCAAGGGG - Intergenic
1109797922 13:67341139-67341161 CACTCAGGACACCTTCAAAGGGG - Intergenic
1111792790 13:92879751-92879773 CAATAAGGACAATCTCTAAGAGG + Intergenic
1111972132 13:94927508-94927530 CACAAACGACAAGCTGAAAAGGG - Intergenic
1112546990 13:100381030-100381052 TACAAAGGACAATCTCACTGTGG - Intronic
1113933073 13:113978693-113978715 CACCAAGGACATCCTCAGACTGG + Exonic
1115154595 14:30323433-30323455 AACAAAGTACAATGTCAAAGTGG - Intergenic
1115249093 14:31327785-31327807 TACAAAGTAATACCTCAAAGGGG + Intronic
1117941766 14:60974766-60974788 CGTAAAGGACAACTACAAAGTGG + Exonic
1118616501 14:67577720-67577742 CACAAAGGACATGCTAAAATAGG - Intronic
1118896591 14:69950315-69950337 CACACTGGCCAAACTCAAAGAGG - Intronic
1120164738 14:81185226-81185248 CACAAAGGACAACCTCAAAGTGG + Intronic
1120348940 14:83327911-83327933 CACAAAACACAACCAGAAAGAGG - Intergenic
1122058736 14:99122587-99122609 CACAAAGTTCAACCACAAGGCGG + Intergenic
1123121275 14:105918170-105918192 CACAAAGATCAACCCCAAACCGG - Intronic
1125521836 15:40352431-40352453 CACAATGGACAACCCCAGAATGG - Intronic
1126477647 15:49082544-49082566 CAGAAGGGACAATCTGAAAGTGG + Intergenic
1128613528 15:69091977-69091999 CACAAAGGAGCACCTCCAAATGG + Intergenic
1128680628 15:69648797-69648819 AACTAAGGACAACCCCCAAGAGG - Intergenic
1128768968 15:70267643-70267665 CACAAAGAAGATGCTCAAAGAGG - Intergenic
1132414962 15:101613178-101613200 CACAAGGGACAGCCCCAGAGAGG - Intergenic
1134648041 16:15886524-15886546 CACACAGGACAGCCTCAAACTGG + Intronic
1136746559 16:32596485-32596507 CACCAAGGTTAAGCTCAAAGGGG - Intergenic
1137490640 16:48929288-48929310 GAAGAAGGACAGCCTCAAAGGGG - Intergenic
1137512024 16:49109053-49109075 CTCAAAGGACAACATTTAAGAGG + Intergenic
1141854991 16:86674676-86674698 CACAGGGGACAAACTCCAAGCGG - Intergenic
1203048688 16_KI270728v1_random:855689-855711 CACCAAGGTTAAGCTCAAAGGGG - Intergenic
1144647242 17:16983504-16983526 AACACAGGACATCCTCAATGTGG + Intergenic
1145207241 17:20991124-20991146 CACCAAGGGCAACCTCAACTTGG - Intergenic
1146926725 17:36750688-36750710 CACAAAGGAGGGCTTCAAAGAGG - Intergenic
1147236377 17:39060667-39060689 CACAGAGAACAACCTCAGATGGG + Intergenic
1147529730 17:41264402-41264424 AACAATGGTAAACCTCAAAGAGG + Intergenic
1149327538 17:55547541-55547563 CATTAAGGGCAACCTGAAAGGGG - Intergenic
1152945661 17:83196146-83196168 TACAAAGAACAACCACAAACTGG - Intergenic
1156145827 18:34176464-34176486 CCCATAGGTCAAACTCAAAGAGG + Intronic
1156559581 18:38107478-38107500 AACAAAGGACATACTCAAAAAGG + Intergenic
1156837718 18:41575185-41575207 CTCAAAGGAGAAGCTCAATGAGG + Intergenic
1157320547 18:46630744-46630766 CAAAAGGGACAACATCAAAGTGG + Intronic
1157957745 18:52117645-52117667 AACAAAAGAGAACCTCAAAAGGG - Intergenic
1158622854 18:59047713-59047735 CACACATGAGAACCTCAAAATGG - Intergenic
1164255561 19:23525120-23525142 CACAAATCACAATCTCAATGTGG + Intergenic
1164689358 19:30198429-30198451 CCCAAGAGCCAACCTCAAAGAGG + Intergenic
1166168933 19:41013281-41013303 CACAAAGGACATGCTCACAAGGG + Intronic
927004455 2:18833567-18833589 CTGAAAGGACAACTACAAAGAGG - Intergenic
927202259 2:20585064-20585086 CACCAAGGACAACCTCCAAAAGG + Intronic
931067147 2:58599701-58599723 CACAAAGGTCAACCTCCAAATGG - Intergenic
932178987 2:69628451-69628473 CACATAAGACAAGCTCAGAGAGG + Intronic
938107434 2:128542882-128542904 CTCAAAGGACAGACTCAATGAGG - Intergenic
939600738 2:144187137-144187159 CAGACAAGACAACCACAAAGTGG - Intronic
941477226 2:165965245-165965267 CACAAAAAACAACAGCAAAGAGG - Intergenic
943280797 2:185930056-185930078 CAGAGAGGAAAAACTCAAAGTGG + Intergenic
943357241 2:186871550-186871572 CACCAAGGCAAACCCCAAAGAGG - Intergenic
944101039 2:196027863-196027885 CACAAAGGAGAAGCACAGAGTGG + Intronic
947099077 2:226600067-226600089 CACAAATCTCAAACTCAAAGAGG + Intergenic
947917467 2:233842951-233842973 CACAAAAGCCAGCCTGAAAGGGG + Intronic
948513740 2:238489803-238489825 CACAAAAGCCAACTTCCAAGAGG - Intergenic
1170826364 20:19799551-19799573 CACAATGAACAACCACACAGAGG - Intergenic
1171200083 20:23233616-23233638 CATAAAGGACAAGCTCTGAGTGG + Intergenic
1173359430 20:42328045-42328067 CACAAATGAAAACCTCCAACTGG + Intronic
1175713208 20:61237643-61237665 GCCAAAGGACAACTCCAAAGGGG - Intergenic
1177892215 21:26819977-26819999 CCCAAATGACAACCTTAAAAGGG - Intergenic
1179410604 21:41160023-41160045 CCCAAAGGACAATCTCCAAATGG + Intergenic
1182962762 22:34491047-34491069 AATAAATAACAACCTCAAAGGGG - Intergenic
949576383 3:5342809-5342831 CATAAAGGACAAGCTCCAGGTGG - Intergenic
949921942 3:9009947-9009969 CACAGAGCAGACCCTCAAAGGGG + Intronic
950515087 3:13459975-13459997 CACAAAAAACAGCCCCAAAGAGG + Intergenic
953401289 3:42620787-42620809 CACAAGGAACAACCACAAAGTGG - Intronic
953648651 3:44779154-44779176 CACAAAAACCAACCTCAAGGAGG - Intronic
954982782 3:54761351-54761373 CACAGAGGACAAGCTAAGAGGGG - Intronic
956478082 3:69644541-69644563 CACAAAGGATTATGTCAAAGTGG + Intergenic
956991315 3:74769452-74769474 CACAAAAGCCCACCTCAAAATGG - Intergenic
957595930 3:82266014-82266036 CACAAAGGAAAACTGCAAAAAGG - Intergenic
959028667 3:101272031-101272053 CACGAAGTACAACATCAGAGAGG - Intronic
960648377 3:119916503-119916525 CACAAATGAAAAGCTCAGAGAGG + Intronic
961478010 3:127160651-127160673 CAGAAAGTCCATCCTCAAAGGGG - Intergenic
962286286 3:134087834-134087856 CACACAGGCCAGTCTCAAAGGGG - Intronic
962380313 3:134893404-134893426 AACAAAGAACAACCTTAATGTGG + Intronic
963961725 3:151316764-151316786 CCCAAAGGACAATCTCTAAAGGG - Exonic
964386569 3:156154154-156154176 CAGAAAGCACCACCTCTAAGTGG - Intronic
966985509 3:185176216-185176238 CACAAAGGATAAAATAAAAGAGG + Intergenic
967947937 3:194818837-194818859 CAGAAAGGATAACCTGGAAGAGG - Intergenic
973280807 4:48359081-48359103 AACAAATTACAATCTCAAAGTGG + Intronic
974872919 4:67665696-67665718 CACAAAGGACAAAATCAAGGTGG + Intronic
976544077 4:86313571-86313593 CACAAAGGAAGACATCCAAGTGG + Intronic
976847366 4:89505171-89505193 CCCAAAAGCCAACCTAAAAGAGG - Intergenic
978227407 4:106353752-106353774 CAAAAGGGACAACCTGCAAGGGG + Intergenic
979644048 4:123046267-123046289 CACAAAAGACAGCTTAAAAGAGG - Intronic
984749433 4:183257443-183257465 CACAAAGGGCAGCTTGAAAGGGG + Intronic
985875137 5:2588626-2588648 CACACAGAACATCCTCACAGAGG - Intergenic
989516722 5:42352806-42352828 CAAAATGCACAACTTCAAAGAGG + Intergenic
990670507 5:58124310-58124332 GACAAAGGAAAACCTCAACTTGG - Intergenic
993222648 5:85120890-85120912 GACAAAGGACAACATCTAAAAGG - Intergenic
994756969 5:103805723-103805745 CAAAAAGGTAAAGCTCAAAGTGG - Intergenic
996987800 5:129588316-129588338 TACAAAGAACAACGTCATAGAGG - Intronic
997919192 5:137961983-137962005 CACCAAGGATAAATTCAAAGAGG + Intronic
998138006 5:139684584-139684606 CACAGAGGCCAACCTGAAGGAGG + Intergenic
1001253246 5:170164894-170164916 CACTAATGACAACCACAGAGTGG - Intergenic
1005022243 6:21429514-21429536 CACACAGGACAACCCCAAAAGGG + Intergenic
1008796342 6:55308116-55308138 CTCAAAGGAAAACATAAAAGTGG - Intergenic
1009643588 6:66368740-66368762 CAGAAAGGACAAGCTGAGAGTGG + Intergenic
1010110029 6:72216377-72216399 GCAAAAGGACAACCTCAAACAGG - Intronic
1010227920 6:73508562-73508584 CACAAGAAACAACCTCAAGGAGG + Intronic
1013159467 6:107527809-107527831 CACTTAGGACAATCTCAAGGGGG - Intronic
1013884270 6:114943204-114943226 CAAAAAAAATAACCTCAAAGAGG - Intergenic
1014989172 6:128052896-128052918 CACAATTGCCAACCTCAAGGGGG - Intronic
1015956782 6:138607028-138607050 AAGATAGGACATCCTCAAAGAGG + Intronic
1024538173 7:50455661-50455683 CTCACAGGACAGACTCAAAGAGG - Intronic
1024698847 7:51884851-51884873 GACAAAGGACCACTTCAAAAAGG + Intergenic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1031065132 7:117096359-117096381 CAGAAATGACAAGCTCACAGGGG + Intronic
1031512952 7:122671420-122671442 CACAAAGAATAACATCACAGAGG + Intronic
1033428385 7:141265996-141266018 CACTCAGGACAAGCTCACAGGGG - Intronic
1033507610 7:142021074-142021096 AACAAATTACAACCTTAAAGTGG - Exonic
1037012787 8:13865281-13865303 CAGAAAAGGCAACCTCAAAATGG - Intergenic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1037802605 8:22043673-22043695 CACAGAGGTCAAGCCCAAAGAGG + Intronic
1039519050 8:38155200-38155222 CACAGAGGACAGCCTCTGAGGGG - Intergenic
1042652216 8:71055552-71055574 TTCAAAGGAGAACATCAAAGAGG - Intergenic
1043150035 8:76704226-76704248 CACAGATGACAACCTGAAAACGG + Exonic
1044170483 8:89045110-89045132 CATAAAGGGCAACATCAAAATGG - Intergenic
1044551174 8:93514191-93514213 CACAAATGACAAATTCAGAGAGG - Intergenic
1046741111 8:117830014-117830036 CACAAAGGAAAACCTACATGGGG - Intronic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1055807087 9:80107966-80107988 CTAAAAGGACATCCTAAAAGTGG - Intergenic
1059496445 9:114713618-114713640 CACAAAGCACGACATAAAAGTGG + Intergenic
1060126252 9:121050351-121050373 CAGAAAGGTGAACCTCTAAGTGG + Intergenic
1060768505 9:126312950-126312972 CACAAATGACAAACCCAAAGGGG - Intergenic
1062117177 9:134815700-134815722 CACAAAGAACCACCAGAAAGAGG - Intronic
1186092523 X:6065097-6065119 CACAAGGGTCTACTTCAAAGTGG + Intronic
1190724022 X:53175004-53175026 TACAAAGGAAAACCACAAAATGG + Intergenic
1190854756 X:54283000-54283022 CACAAAGGACACCATCAAGAAGG + Intronic
1193961611 X:87932395-87932417 CACAAGGAACAAAGTCAAAGAGG - Intergenic
1194855459 X:98922305-98922327 CACTAAGGACAAACTCAAAAGGG - Intergenic
1198791317 X:140349902-140349924 CACTAAGGACAAACCCAAAGAGG - Intergenic