ID: 1120168411

View in Genome Browser
Species Human (GRCh38)
Location 14:81224710-81224732
Sequence TTTGATTTTCCAACAACGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120168411_1120168416 12 Left 1120168411 14:81224710-81224732 CCTATCGTTGTTGGAAAATCAAA No data
Right 1120168416 14:81224745-81224767 TGCTTTGACAAGTATTTGGTGGG No data
1120168411_1120168417 29 Left 1120168411 14:81224710-81224732 CCTATCGTTGTTGGAAAATCAAA No data
Right 1120168417 14:81224762-81224784 GGTGGGTGTTTTATTATTAATGG No data
1120168411_1120168415 11 Left 1120168411 14:81224710-81224732 CCTATCGTTGTTGGAAAATCAAA No data
Right 1120168415 14:81224744-81224766 GTGCTTTGACAAGTATTTGGTGG No data
1120168411_1120168414 8 Left 1120168411 14:81224710-81224732 CCTATCGTTGTTGGAAAATCAAA No data
Right 1120168414 14:81224741-81224763 GAAGTGCTTTGACAAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120168411 Original CRISPR TTTGATTTTCCAACAACGAT AGG (reversed) Intergenic
No off target data available for this crispr