ID: 1120169404

View in Genome Browser
Species Human (GRCh38)
Location 14:81233959-81233981
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120169404_1120169408 16 Left 1120169404 14:81233959-81233981 CCTGCCATTTTCTGCAGATAACT No data
Right 1120169408 14:81233998-81234020 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1120169404_1120169406 4 Left 1120169404 14:81233959-81233981 CCTGCCATTTTCTGCAGATAACT No data
Right 1120169406 14:81233986-81234008 TTCTTTTGAGAGACAGCTCTTGG 0: 15
1: 201
2: 219
3: 189
4: 415
1120169404_1120169407 15 Left 1120169404 14:81233959-81233981 CCTGCCATTTTCTGCAGATAACT No data
Right 1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120169404 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr