ID: 1120174348

View in Genome Browser
Species Human (GRCh38)
Location 14:81277394-81277416
Sequence TGCCCACCACCACCACAAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120174348_1120174354 30 Left 1120174348 14:81277394-81277416 CCACTTTGTGGTGGTGGTGGGCA 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1120174354 14:81277447-81277469 CTTTGACGAGGATGTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 71
1120174348_1120174351 18 Left 1120174348 14:81277394-81277416 CCACTTTGTGGTGGTGGTGGGCA 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1120174351 14:81277435-81277457 CTATTTCATTCCCTTTGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120174348 Original CRISPR TGCCCACCACCACCACAAAG TGG (reversed) Exonic
900407432 1:2498752-2498774 TGATCTCCACCTCCACAAAGGGG - Exonic
900479481 1:2891206-2891228 CCCCCACCCCCTCCACAAAGAGG + Intergenic
900889594 1:5440152-5440174 TGTCCATCACAACCACACAGAGG + Intergenic
901203372 1:7479425-7479447 TCCCCATCACCACCCCAAAATGG + Intronic
901296569 1:8165551-8165573 TGGCCACCCCAACCATAAAGGGG - Intergenic
902402695 1:16166762-16166784 TCCCCACCACCCCCCCAAAAAGG - Intergenic
904343825 1:29855355-29855377 AGTCCACCCCCACCAGAAAGGGG - Intergenic
905529126 1:38662481-38662503 TTCCTACCACCACCACAGAAAGG + Intergenic
909519669 1:76552468-76552490 TACTCACCTCCTCCACAAAGAGG - Intronic
911470014 1:98306864-98306886 TGCCCAACACACCCACAAAAGGG - Intergenic
916937902 1:169649082-169649104 CTCCCACCACCACCACAATGGGG + Intergenic
916985997 1:170191844-170191866 TCCCCACCAGCACAACATAGCGG - Intergenic
918096386 1:181338384-181338406 TGCACATCAAAACCACAAAGGGG - Intergenic
918667185 1:187166312-187166334 TTCCCAACACCACCACAATGGGG - Intergenic
920595792 1:207268702-207268724 CCACCACCACCACCACAAAATGG + Intergenic
920693407 1:208163950-208163972 TCATCACCACCCCCACAAAGGGG + Intronic
922333509 1:224598881-224598903 TGCAGACCACCACAATAAAGTGG - Intronic
923920455 1:238558631-238558653 TGCCGACCAGCAGCACGAAGAGG - Intergenic
924665721 1:246069797-246069819 TGCCCACCACCAACCCCAAATGG - Intronic
1063228764 10:4042993-4043015 TGCCAACAACCACCACACATTGG - Intergenic
1064551767 10:16508438-16508460 TGCACCTCACTACCACAAAGGGG - Intronic
1065308856 10:24395098-24395120 TGACCACCATCACCACATAAGGG + Intronic
1066066662 10:31765917-31765939 TGCCCACCCCCACCTCAGAGTGG + Intergenic
1067173415 10:43925759-43925781 TGCCCAGCACCATCACACTGGGG + Intergenic
1067262928 10:44710071-44710093 TACCCACCACCACCATACATAGG + Intergenic
1067512020 10:46904106-46904128 GGCCCTGCTCCACCACAAAGGGG - Intergenic
1067650227 10:48147718-48147740 GGCCCTGCTCCACCACAAAGGGG + Intergenic
1068569851 10:58616722-58616744 TGGCCAAGTCCACCACAAAGTGG - Intronic
1068613402 10:59085767-59085789 TGCCCATCACCACCAAAACATGG - Intergenic
1069507578 10:69014715-69014737 TGCCCCCCCCCACCCCCAAGAGG + Intronic
1069680347 10:70280337-70280359 TTCCCACCAACACCACACAAGGG + Intronic
1069941223 10:71956785-71956807 TGACCACTACCACCAAAATGTGG - Intergenic
1071137544 10:82469456-82469478 CCACCACCACCACCACTAAGAGG - Intronic
1072077221 10:91989541-91989563 TGTCCAGTACCAACACAAAGTGG + Exonic
1075055808 10:119217613-119217635 TCCCCACCACCACCACCCATGGG - Intronic
1077117595 11:892270-892292 TGCCCACCAGCACCACCCACAGG + Intronic
1077161634 11:1115583-1115605 TGCCCACCACCACCACCTCCCGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078848164 11:15140418-15140440 GGCCCACCAGCACCTCAGAGTGG - Intronic
1080936592 11:36870106-36870128 CAACCACCACCACCACAAAAAGG + Intergenic
1081495165 11:43601937-43601959 TGCCCAGCCCCACCCCAAAATGG + Intronic
1081631707 11:44694021-44694043 TGACTACCCCCACCCCAAAGAGG - Intergenic
1081692490 11:45087861-45087883 TGCCCACCCCCACCCGAGAGTGG - Intergenic
1083063547 11:59899543-59899565 TGCCAACAAACACCACAAGGCGG + Intergenic
1083426891 11:62592787-62592809 ACCCCACCACCACCCCCAAGGGG + Intergenic
1086155099 11:83656887-83656909 TTCCCTCCACCCCCACCAAGAGG + Intronic
1086488045 11:87329627-87329649 TGTCCCCCACAACCACAAATAGG + Intergenic
1089711750 11:120319987-120320009 TGCCCCCCACAACAACAAAAAGG - Intergenic
1090324770 11:125875346-125875368 AGCCCAACATCACCACATAGGGG + Intergenic
1091672467 12:2462153-2462175 TGCCGGCCACCACCCCACAGTGG - Intronic
1092229742 12:6769852-6769874 TGCCCACCATCACCACCAATGGG - Intronic
1092729055 12:11511231-11511253 TGCCCACCTCCCCCAAAAAAAGG - Intergenic
1094794438 12:33954474-33954496 TTCCCAACACCACCACAATGGGG + Intergenic
1095106289 12:38237080-38237102 TTCCCAACACCACCACACTGGGG + Intergenic
1095355077 12:41263186-41263208 CCCCCACCACCACCAAAAAAAGG - Intronic
1096616161 12:52834584-52834606 TGGCCACCCCCACCACCCAGTGG + Intergenic
1098322363 12:69258817-69258839 GGCCCACCACCTCCACAACAGGG + Exonic
1099092704 12:78333637-78333659 TGCCCACTGCCACCAGAAACTGG + Intergenic
1100013518 12:89981585-89981607 TGACCACTTGCACCACAAAGAGG - Intergenic
1100325965 12:93540183-93540205 TCCCCAAACCCACCACAAAGAGG + Intergenic
1101706617 12:107226381-107226403 TGCCCCCCACCCCCACCAGGGGG + Intergenic
1103895765 12:124272246-124272268 TCCCCACCAGCTCCACAAAAGGG + Intronic
1106184975 13:27401383-27401405 AGCCCAGCCCCACCATAAAGAGG - Intergenic
1107717723 13:43217116-43217138 TGCCCACCTCCACCAGGGAGAGG + Intronic
1109414196 13:62014461-62014483 TATCCACCAGCACCACCAAGTGG - Intergenic
1109537671 13:63739640-63739662 GGCTCTCCACCACCACAAAATGG + Intergenic
1111404137 13:87780003-87780025 TGTCTACCACCACCGCAGAGAGG - Intergenic
1113474162 13:110568157-110568179 TGCCCAGCAGCCCCATAAAGAGG - Intergenic
1113764892 13:112875040-112875062 TGCCCGCCACCAGCACCACGTGG + Intronic
1116082944 14:40199391-40199413 TTCCCACCAGAACCACAGAGAGG - Intergenic
1119750211 14:77071995-77072017 CTCCCACCACCACCACACCGAGG + Intergenic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1120878267 14:89394180-89394202 CTCCCAACACCACCACAATGGGG + Intronic
1121321641 14:92995052-92995074 TGCCCACCACCACCACCACTGGG + Intronic
1122721878 14:103726854-103726876 TTCCCACCACCCCCACTCAGCGG - Intronic
1123762887 15:23446542-23446564 GGCCCTCCACCACCCCACAGAGG - Intronic
1124095419 15:26644501-26644523 GGCCAGCCACCACCACAAGGAGG + Intronic
1127530216 15:59836415-59836437 TGCCCCCCACCACCACCATTTGG - Intergenic
1128212754 15:65913845-65913867 GGCCCAGCAGCACCACAATGAGG + Exonic
1129757054 15:78105004-78105026 TGCTCCCCACCCCCCCAAAGAGG - Exonic
1130389042 15:83438855-83438877 TTCTCAACACCACCACAAGGTGG + Intergenic
1133070816 16:3245706-3245728 TTCCCACCAGCAGCACACAGGGG - Intronic
1133215244 16:4288353-4288375 CCCCCGCCACCACCCCAAAGAGG - Intergenic
1133319188 16:4902545-4902567 TGCCAACCAGCCCCACTAAGTGG - Intronic
1133510134 16:6450083-6450105 TCCCCACCACCTCCTCAAAGAGG - Intronic
1133636926 16:7675757-7675779 TCCTCACCATCACCATAAAGGGG - Intronic
1134061409 16:11201873-11201895 TGCCTCCCAGCACCACAGAGAGG + Intergenic
1134107443 16:11494334-11494356 TGCCCCCCAACACCACTGAGTGG - Intronic
1135905919 16:26511645-26511667 GGCCCTCCCCCACCACAAAGGGG + Intergenic
1138096645 16:54217150-54217172 TGCCCTCCACCAATGCAAAGAGG - Intergenic
1142285285 16:89169081-89169103 TGCACACCCCAACCACTAAGGGG - Intergenic
1143376414 17:6470213-6470235 TGCCCACAGCCACCCCAAGGGGG - Intronic
1143453364 17:7050292-7050314 TTCCCAGCACCCCCACCAAGGGG + Intergenic
1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG + Intronic
1143869369 17:9947150-9947172 TGCTCACCCCCACCCCAAATGGG + Intronic
1144624078 17:16835856-16835878 CACCCACCCCCACCCCAAAGAGG + Intergenic
1144784151 17:17822672-17822694 TGCCCACCACCAGCTTGAAGTGG + Intronic
1144825417 17:18103046-18103068 TGGCTACAACCACCACAAAATGG - Intronic
1144882348 17:18436863-18436885 CACCCACCCCCACCCCAAAGAGG - Intergenic
1145149886 17:20507523-20507545 CACCCACCCCCACCCCAAAGAGG + Intergenic
1145166323 17:20615436-20615458 TGCCCTCCACCATCAGGAAGGGG + Intergenic
1148533365 17:48416441-48416463 TGCCCACCACCACCAGTACAAGG - Intronic
1148960974 17:51392536-51392558 TGGCAACCACCATCACAAGGTGG + Intergenic
1150841742 17:68613987-68614009 TCCCCACCACCACCACTCTGTGG - Intergenic
1151547369 17:74801348-74801370 TGCCCACCACCACCAGGAGCTGG + Intronic
1151686793 17:75652279-75652301 TGCCCACCCCCACCCCACATGGG - Intronic
1152497304 17:80682584-80682606 TGCCCACGGCCACCAGAAACTGG + Intronic
1152585279 17:81186508-81186530 TGATCACCCCCACCCCAAAGTGG - Intergenic
1152663429 17:81553357-81553379 TCCCCACCCCAACCTCAAAGGGG - Intronic
1152896413 17:82913908-82913930 TGCCCACGACAACCACACGGAGG - Intronic
1154308973 18:13253137-13253159 TGCCCACCACCACCACCACCAGG - Intronic
1155562657 18:27095958-27095980 TGCCCCCAACAACCACAAAATGG + Intronic
1157449207 18:47772806-47772828 TGCACCCCACCACCAGAAGGCGG + Intergenic
1159017160 18:63110609-63110631 TCCCCACCACCACCACCAGCTGG - Intergenic
1159643684 18:70892348-70892370 TGGCCAGCAGCACCAGAAAGAGG + Intergenic
1160024070 18:75204634-75204656 TCCCCACCGCCACCACGGAGAGG + Intronic
1160074634 18:75661769-75661791 TACCCACCCCCACCAAAAAGAGG - Intergenic
1160194703 18:76742934-76742956 TGTCCACCACCACCAAAAGCAGG - Intergenic
1160313580 18:77820567-77820589 TGCACAGCACAACCACACAGAGG + Intergenic
1160823323 19:1068124-1068146 TCCCCACCCCCACCAGGAAGTGG + Intronic
1164684310 19:30156953-30156975 TGTCCACCACCAACTGAAAGTGG - Intergenic
1164756243 19:30691887-30691909 TGCCCACCACTGCCACAGCGTGG - Intronic
1165588403 19:36943047-36943069 TGTCAAACACCACCACAAGGAGG - Intronic
1165993195 19:39827389-39827411 TGCCCAGCACCTCCACAATGCGG + Exonic
1166925669 19:46265428-46265450 TGCCCCCCTCCACCACATGGGGG - Intergenic
1167280444 19:48564635-48564657 TGCCCACCACCACTAAAATTTGG + Intronic
1168320158 19:55504196-55504218 TGCCCGCCTCCACCACGAGGGGG - Intronic
928282924 2:29964477-29964499 GGCCCCCCACCCCCACAAAGGGG - Intergenic
929447194 2:42010828-42010850 CCCCCACCTCGACCACAAAGTGG + Intergenic
930007688 2:46911015-46911037 TGTCCTCCACCACCAAAAAAAGG + Intronic
930060872 2:47287322-47287344 GGCCCAACACCACCACATTGGGG + Intergenic
934085581 2:88506415-88506437 TCCCCACCAGCTCCACAAATGGG - Intergenic
934943729 2:98521037-98521059 TCCCCACCCCCACCCCAATGGGG + Intronic
935755868 2:106275912-106275934 GGCCCACCTCCACCCCAAGGTGG + Intergenic
935765544 2:106363812-106363834 TGGCCACCACTAACACCAAGAGG - Intergenic
935783817 2:106531306-106531328 TTCCCACTACCACTAAAAAGGGG - Intergenic
936397996 2:112143587-112143609 TGGCAACCACCACCACAATCAGG + Intronic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG + Intergenic
938405675 2:131031927-131031949 TCCCCACCACCACCACCGTGTGG + Intronic
939185034 2:138850540-138850562 TGCAGACTACCACCATAAAGTGG - Intergenic
939461589 2:142503365-142503387 AGACCAACACCACCAGAAAGGGG + Intergenic
940235407 2:151506021-151506043 TGTGTACCACCACCACACAGTGG - Intronic
940259537 2:151765789-151765811 CCACCACCACCACCACAGAGTGG + Intergenic
942428702 2:175886419-175886441 TCCCCACCACCCCCAAAAACAGG + Intergenic
942625187 2:177893032-177893054 TGCCCACCACCACCACTATACGG + Intronic
944379237 2:199087992-199088014 GGCCCCACACCACCAAAAAGAGG + Intergenic
947480911 2:230499211-230499233 TCCCCACCTCCACCACATAGAGG + Intronic
947528374 2:230893377-230893399 TCCCTACCTCTACCACAAAGGGG - Intergenic
948615495 2:239196141-239196163 TTCCCCCCACCCCCACATAGAGG - Intronic
948971318 2:241429529-241429551 TTACCACCACCACCACCAATGGG - Intronic
1172105226 20:32513176-32513198 TGCCCTCTACCATCACAAGGAGG + Intronic
1173793435 20:45842486-45842508 TCCCCACTACCACCACCAAGGGG + Intronic
1174005381 20:47406782-47406804 TGCACACCACCACCACATCCAGG - Intergenic
1174267066 20:49339747-49339769 TCCCCACCAACACCTCAGAGGGG + Intergenic
1174843577 20:53921886-53921908 TCTCCACCACCACCACAACGCGG - Intergenic
1175334651 20:58187324-58187346 TGACCACCACCACCAACATGAGG - Intergenic
1179493473 21:41756521-41756543 TGCCCACTACCACGTCAAGGTGG - Exonic
1179798645 21:43799983-43800005 TCCCCACCAGCACCCCAACGAGG - Intronic
1179898955 21:44379026-44379048 AGCCCTCCACAACCACACAGGGG - Exonic
1181278756 22:21703627-21703649 TGCCCGCCACCACCATCAATGGG + Intronic
1181741615 22:24925672-24925694 TGCACCCCACCACCATTAAGTGG - Intronic
1182413960 22:30209219-30209241 TGCCCACCGCCCCCAAAAAAGGG + Intergenic
1183320905 22:37164478-37164500 TGCCCACCACCCCCACCACCCGG - Intronic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
1184600897 22:45542755-45542777 TGCCAACCACTCCCCCAAAGTGG + Intronic
1184614944 22:45631563-45631585 TGACCACCACCAACATTAAGCGG - Intergenic
1184632086 22:45789664-45789686 CCACCACCACCACCACAAAGGGG - Intronic
1185392585 22:50570681-50570703 AGGACACCAACACCACAAAGAGG + Intronic
949292185 3:2479910-2479932 TATACACCACCACCACCAAGTGG + Intronic
950089691 3:10286856-10286878 TGCCCATCCCCATCTCAAAGGGG + Intronic
950881503 3:16326275-16326297 TGGTCACCAGCTCCACAAAGGGG - Intronic
951492994 3:23293098-23293120 TCACAACCACCACCACAAAAAGG - Intronic
951809088 3:26679720-26679742 TGCCCTCCTCCACCAGAATGTGG + Intronic
952387776 3:32855359-32855381 TGCCCTCCCCCACCCCACAGTGG - Intronic
954213829 3:49113137-49113159 TGGGATCCACCACCACAAAGGGG + Intronic
955016298 3:55073478-55073500 TGTCCACCACCACCATGAACAGG - Exonic
955712581 3:61795819-61795841 TCCCCACCCCCATTACAAAGTGG + Intronic
956629625 3:71303343-71303365 TGCCCCCCATCACCACCCAGGGG - Intronic
956692288 3:71889409-71889431 CACCCACCACCACCACAAACAGG - Intergenic
957752818 3:84444522-84444544 TGACCACCATCACCACTAATTGG + Intergenic
958666114 3:97139604-97139626 GGCCCACTAACAGCACAAAGAGG + Intronic
958922465 3:100122272-100122294 AGCCCACCCACACCAGAAAGGGG - Intronic
967982492 3:195074127-195074149 TCACCACCACCACCTCCAAGAGG + Intronic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
969436985 4:7194013-7194035 TTCCCCCCACCCCCACAAAAGGG + Intronic
976608674 4:87007017-87007039 TGCCCAGCAACAGCACAACGCGG - Intronic
977883929 4:102236723-102236745 TGCCCTCCTAGACCACAAAGAGG - Intergenic
978227964 4:106361358-106361380 TTCCCACCTCCACCCCAAAATGG - Intergenic
978311805 4:107392566-107392588 AGCACACCACCACCACTGAGAGG - Intergenic
979746573 4:124221686-124221708 TGCCAACCCCCACCAGAAGGTGG + Intergenic
980305482 4:131055133-131055155 TTCCCAGCACCATCAAAAAGTGG - Intergenic
981666666 4:147234976-147234998 TGCCCAGCACCACCTGGAAGAGG + Intergenic
985351106 4:189062224-189062246 TGCTCACCAGCACCACACTGTGG + Intergenic
985494997 5:199347-199369 TGGCCACGTCCACCACACAGAGG - Exonic
985952214 5:3230994-3231016 TGCCCAGAAGCACCACAGAGCGG - Intergenic
986332004 5:6724202-6724224 TTCCCACCTCCCCCACAGAGAGG + Intronic
986348062 5:6852869-6852891 TGTCCACAACCAGCTCAAAGTGG - Intergenic
988093389 5:26569866-26569888 CACCCACCACCACTACAGAGTGG - Intergenic
990433660 5:55765256-55765278 GGCCCACCATCTCTACAAAGGGG - Intronic
990894292 5:60681253-60681275 TGCCCACTACCACCACCCAAGGG + Intronic
992626383 5:78639159-78639181 TTCCCACCACCACCACCATTGGG + Intronic
993635639 5:90340195-90340217 TGAACACCAACACCCCAAAGAGG + Intergenic
993752646 5:91690091-91690113 TACCCACCAGCACCATATAGGGG + Intergenic
994537346 5:101048701-101048723 TGCCCACCACCAACCCAAATTGG + Intergenic
994577681 5:101600533-101600555 TGCACACCAAAACCACAATGAGG + Intergenic
996666611 5:126066953-126066975 TGGCCACCACCAGCCCACAGAGG - Intergenic
997228804 5:132228309-132228331 TTCCCAGCACCACCACAAGGAGG + Intronic
997485714 5:134228530-134228552 GGCTCACCACCATCACAAAATGG + Intergenic
999717542 5:154373527-154373549 CCCACACCACCACCACAAACTGG - Intronic
1001745466 5:174089304-174089326 TGCCCACCTTCGCCCCAAAGAGG + Intronic
1002602152 5:180360137-180360159 TGGCCACCCCCAGCACACAGTGG - Intergenic
1003301430 6:4886436-4886458 TGCACATCACAACCACAATGCGG - Intronic
1005277137 6:24231281-24231303 TGCTCACCCCCATCACCAAGAGG + Intronic
1005724789 6:28637977-28637999 TGCCCACCCCCCCCCCAAATTGG - Intergenic
1006437983 6:34036315-34036337 TGCCCACCACGGCCAGGAAGAGG + Exonic
1006472875 6:34237964-34237986 TGCCCTCCGCCCCCACAAACTGG + Intronic
1006595874 6:35192246-35192268 GCCCCACCAACACCCCAAAGTGG - Intergenic
1011141576 6:84163833-84163855 TGCCCGCCACCATGACAAATGGG + Intronic
1011411016 6:87066223-87066245 TTCCCACCACCACTCCATAGGGG - Intergenic
1012529924 6:100222952-100222974 TGCCCAACCCCATCAAAAAGTGG + Intergenic
1013119994 6:107132542-107132564 GGCCGACCACCACCACCAGGTGG + Intergenic
1013301361 6:108808084-108808106 TGCCCACAACCCCCCCACAGAGG + Intergenic
1014486005 6:121999966-121999988 TGCCCACTAAAACCACAAATGGG - Intergenic
1016751028 6:147631023-147631045 TCCATACCACCCCCACAAAGTGG - Intronic
1019658601 7:2211131-2211153 TGCCCACCACCAGCTTAAAGTGG - Intronic
1021008640 7:15434100-15434122 TGACTACCACAACCACAAAAAGG - Intronic
1021586115 7:22210422-22210444 TGCCCTCCACCATCAAAGAGAGG - Intronic
1024034336 7:45494971-45494993 AGCGCACCCCCTCCACAAAGGGG - Intergenic
1024305165 7:47922738-47922760 TGCCCCCCACCTCCCCAACGGGG - Intronic
1027679565 7:81203442-81203464 TCCCCACCCCCCCAACAAAGTGG - Intergenic
1028646760 7:93107015-93107037 TACCCAACAACACAACAAAGAGG - Intronic
1029995156 7:105000855-105000877 TGCCCCACTCCACCACAGAGTGG + Intergenic
1032467887 7:132158005-132158027 TCCCCACCACCATCACACATTGG + Intronic
1032845693 7:135749617-135749639 TGGGCACCACCTCCACAAACTGG - Intergenic
1034388012 7:150756439-150756461 CACCCACCACCACAACACAGAGG - Intergenic
1034734374 7:153414493-153414515 TAGCCACCACCACCACAGTGGGG + Intergenic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1037502594 8:19499932-19499954 TTCTCACCATCACCACAAGGAGG + Intronic
1038345615 8:26729747-26729769 TGACTACCACCAATACAAAGGGG + Intergenic
1039366584 8:36934403-36934425 TACCCACCACCAAGACAATGGGG + Intronic
1039905984 8:41786668-41786690 TGGCACCGACCACCACAAAGGGG - Intronic
1040337648 8:46424190-46424212 AGCCCACCAACGCCACACAGTGG - Intergenic
1040368674 8:46746737-46746759 AGCCCACCACTAACACCAAGTGG - Intergenic
1040695487 8:49992655-49992677 TGCCTACCATCAGCAGAAAGGGG + Intronic
1044833246 8:96270502-96270524 TGTGCACCACCACCACAGACTGG + Intronic
1048776821 8:137955672-137955694 TGCCCACCACCAAAACACAATGG - Intergenic
1051106571 9:13587563-13587585 TGCACACCTGCACCACAAACGGG - Intergenic
1060241008 9:121903236-121903258 TGCCCAGCATCACAACAAATAGG + Intronic
1060308989 9:122442372-122442394 TGCCCACAACCACCAGAAGCTGG - Intergenic
1060412386 9:123408377-123408399 TGCCAAGCATCACCACTAAGAGG - Intronic
1060883184 9:127133129-127133151 TCCCCACCACCTTCACAGAGGGG + Intronic
1061844567 9:133379794-133379816 TCCCTGCCACCACCACAGAGAGG - Intronic
1062567984 9:137171702-137171724 TGCCCGCCAGCACCACAAGGAGG + Exonic
1187715925 X:22102594-22102616 ACCCCATCACCACCACAAGGAGG + Intronic
1189274052 X:39771991-39772013 AGCTGACCACCACGACAAAGTGG - Intergenic
1189493142 X:41485283-41485305 CCTGCACCACCACCACAAAGTGG + Intergenic
1189928107 X:45978456-45978478 CTCCCAACACCACCACAATGGGG + Intergenic
1192526148 X:71846309-71846331 TTCCCAACACCACCACATTGGGG + Intergenic
1194563230 X:95448425-95448447 GCCCCACCACCAACACATAGGGG + Intergenic
1195517487 X:105794044-105794066 TTCCCACCACCACCACATTGGGG + Intergenic
1196742045 X:119033603-119033625 TGTGCACCACCACGACACAGGGG + Intergenic
1197356209 X:125439501-125439523 ACCCCACCCCCACCACAAAGTGG - Intergenic
1197658945 X:129149116-129149138 TGCCCATGTCAACCACAAAGCGG + Intergenic
1198189683 X:134289479-134289501 CCCCCAGCACCACCACAAAAAGG - Intergenic
1198795646 X:140391177-140391199 TGCCCACCATTACAAGAAAGGGG - Intergenic
1199330440 X:146552156-146552178 CCCCCACCACCACAACACAGGGG + Intergenic
1202109727 Y:21406905-21406927 TGCCCGCCAACACCAGACAGAGG + Intergenic
1202257669 Y:22938553-22938575 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202410659 Y:24572300-24572322 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202460122 Y:25097772-25097794 TGTCCACCCAGACCACAAAGAGG + Intergenic