ID: 1120174531

View in Genome Browser
Species Human (GRCh38)
Location 14:81278757-81278779
Sequence ACATATGAGCTACTGTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120174531 Original CRISPR ACATATGAGCTACTGTTCAG GGG Intronic
901103788 1:6739610-6739632 ACATATGAGCCCACGTTCAGTGG - Intergenic
905657376 1:39693331-39693353 ACACATTAGCTATTGTTAAGGGG - Intronic
907641083 1:56191060-56191082 ACATGTGAGTTATTATTCAGTGG + Intergenic
909706639 1:78592992-78593014 ACATATGCTCTCCTCTTCAGTGG + Intergenic
910106191 1:83633605-83633627 CCCTATTATCTACTGTTCAGAGG - Intergenic
919556829 1:199066521-199066543 ACTTGTGAATTACTGTTCAGGGG - Intergenic
1063612393 10:7573855-7573877 AGAAATGAGCTGTTGTTCAGTGG + Intronic
1068288395 10:54969699-54969721 ACTTTTGAGCTACTTTTCAGAGG - Intronic
1069290474 10:66772771-66772793 ACATTTCAGCTTCAGTTCAGAGG - Intronic
1075005368 10:118826468-118826490 AAATATGGGCCAGTGTTCAGTGG + Intergenic
1075678368 10:124313731-124313753 ACATATGAGTTCATGTGCAGCGG - Intergenic
1078476481 11:11634521-11634543 ACACATGACTGACTGTTCAGGGG - Intergenic
1078563526 11:12393872-12393894 ACCTCTGAGCTACTATTCAGAGG - Intronic
1081422374 11:42884629-42884651 ATATATGGACTACTGTTCAATGG + Intergenic
1088229162 11:107655973-107655995 GCATATAATCTACTGGTCAGCGG + Exonic
1089844899 11:121451080-121451102 GCATACAAGCTGCTGTTCAGGGG - Intergenic
1095267543 12:40177628-40177650 AAAGAAGAGCTACTGCTCAGAGG - Intergenic
1097309908 12:58107289-58107311 CCATAATAGCTTCTGTTCAGTGG - Intergenic
1097567527 12:61289376-61289398 ACAGGTAAGCTAGTGTTCAGAGG + Intergenic
1099244182 12:80174622-80174644 ACATATTGGCTAAAGTTCAGAGG + Intergenic
1100594161 12:96057168-96057190 ACTAAGGAGCTACAGTTCAGAGG + Intergenic
1102812498 12:115836589-115836611 ATATATGAGCCAGTGTTAAGTGG - Intergenic
1104182356 12:126394505-126394527 AAATATCAGCTTATGTTCAGTGG - Intergenic
1106545288 13:30725804-30725826 AGATATGAGCTTCTGATCATGGG + Intronic
1107867399 13:44716124-44716146 AGATATGATCTACTATTCAATGG - Intergenic
1108406289 13:50105863-50105885 GCATATGAGGCACTGTTGAGTGG - Intronic
1112079207 13:95949918-95949940 ACATATAAACTGCTGTTTAGAGG + Intronic
1113145999 13:107208201-107208223 ACATAAGAACTACTGTTCTTAGG + Intronic
1115781247 14:36771033-36771055 ACATATCAGTTACTGTACTGTGG - Intronic
1117325964 14:54669212-54669234 ACAGCTAAGGTACTGTTCAGTGG + Intronic
1120099969 14:80434124-80434146 ACATATTACCAAGTGTTCAGAGG - Intergenic
1120174531 14:81278757-81278779 ACATATGAGCTACTGTTCAGGGG + Intronic
1124887053 15:33696931-33696953 AGCCATGAGCTACTGTTAAGGGG - Intronic
1126418316 15:48442557-48442579 ACATCTTAGCTCCTGTACAGTGG + Intronic
1129124807 15:73430326-73430348 ACATGTGAGGAACTATTCAGCGG + Intergenic
1134615076 16:15644736-15644758 ACAAATACGCTACTCTTCAGAGG + Intronic
1138318078 16:56087503-56087525 ATATATGAGCTGCAGCTCAGGGG + Intergenic
1138463293 16:57166867-57166889 AAATAATAGCTACTCTTCAGTGG - Intronic
1139149415 16:64362714-64362736 TCATATGCGCAATTGTTCAGCGG + Intergenic
1139670304 16:68488256-68488278 ACACATGAGACACTGTTCAGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141359132 16:83378325-83378347 ACATGTGGCCTCCTGTTCAGCGG + Intronic
1141776829 16:86128665-86128687 ACGTACCAGCTGCTGTTCAGGGG - Intergenic
1146553397 17:33801677-33801699 ACAGAAGAGCAACTGTTCACTGG - Intronic
1148660412 17:49326585-49326607 ACATGTGAACTACTCCTCAGGGG + Intronic
1149614106 17:57983494-57983516 ACCTATAAGCTACTCTGCAGTGG + Intronic
1150517136 17:65825544-65825566 AAATGGGAGTTACTGTTCAGTGG + Intronic
1158737281 18:60097412-60097434 AAATAAGATCTAATGTTCAGAGG - Intergenic
1163929230 19:20372964-20372986 ACATATGAGCTAAAGTTAAAGGG + Intergenic
1164779340 19:30880060-30880082 AGTTATGAGCTGTTGTTCAGTGG - Intergenic
1166265296 19:41678507-41678529 TAATATTAGCTACTGTTGAGGGG + Intronic
928117613 2:28558331-28558353 GCATACGAGCTAGTGTTCACAGG + Intronic
930349172 2:50227496-50227518 ACTTATGAGCTGCTCATCAGTGG - Intronic
932614024 2:73220558-73220580 ACATCTGAGCTACAGCTCAGGGG + Intronic
935923270 2:108038405-108038427 ACATCTCAGGTACTGTTAAGAGG + Intergenic
936928242 2:117760041-117760063 ACAAATGAGCTACGTTTTAGCGG + Intergenic
1169114296 20:3053110-3053132 ATATATTAACTACTGTTAAGGGG + Intergenic
1172752508 20:37260543-37260565 ACATTTAGGCTACTGTGCAGTGG - Intronic
1173260462 20:41430454-41430476 TCATATGAGCTACTGCTGGGAGG + Intronic
1174706063 20:52657353-52657375 ACATATGAGCCCCTCTTCAAAGG + Intergenic
1177303210 21:19277395-19277417 TCATATGAGCTGCATTTCAGAGG - Intergenic
949550726 3:5110757-5110779 ACATATGATCAACAATTCAGGGG - Intergenic
950193009 3:10991428-10991450 ACATATGACCTGGTGATCAGTGG + Intergenic
950335728 3:12191242-12191264 ACATAAGAACCACTCTTCAGAGG - Exonic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
951807378 3:26661156-26661178 ACATATTGGCTTCTGTTTAGGGG + Intronic
953742229 3:45547734-45547756 AAATATGAGCTACTGAGGAGGGG + Exonic
956731443 3:72200333-72200355 AGATATGATCTACTGAGCAGAGG + Intergenic
963213046 3:142715614-142715636 AAATATGTGCCACTGTTCACTGG + Intergenic
965222036 3:165938302-165938324 ACATATGGGCTATTGTAAAGTGG - Intergenic
967138430 3:186532334-186532356 AAATATGAGCTGCTGCTAAGTGG + Intergenic
968200890 3:196754320-196754342 ACATAACAGTTACTGTTCAATGG - Intronic
970125180 4:12801335-12801357 AAATATGAGCTAATTTTGAGTGG - Intergenic
970545791 4:17128781-17128803 ACATATGAACTAAAGCTCAGAGG - Intergenic
972773143 4:42217036-42217058 ACATCTGAGCTACTCTTAACAGG - Intergenic
977243662 4:94603986-94604008 AAATATGGGCTACTGCTCATAGG + Intronic
978887165 4:113777903-113777925 AACTATAAGCTACTGCTCAGAGG + Intergenic
979264721 4:118688176-118688198 AGATATGAGCCACTGTGCCGAGG + Intronic
989730017 5:44637671-44637693 ACATGTGAGCTACTCCTCAAAGG - Intergenic
992154403 5:73940604-73940626 AAATATGGGTTACTGTTCATGGG - Intronic
996152279 5:120054058-120054080 AAATATGAGCTTCTGTTCCTGGG + Intergenic
997413964 5:133710955-133710977 ACAAATGAGCAACTGAACAGGGG + Intergenic
999850312 5:155530690-155530712 AAATAAGAGCTACTGTTAAACGG - Intergenic
1000145407 5:158448809-158448831 ACACAGGAGCCACTGATCAGAGG - Intergenic
1002459535 5:179366180-179366202 ACATGTGAGCAACTGTGGAGGGG + Intergenic
1003189441 6:3861369-3861391 ACTTCTGAGCTACTGTTCCTTGG - Intergenic
1003641881 6:7882452-7882474 TCAAATCAGTTACTGTTCAGGGG - Exonic
1007698211 6:43747201-43747223 AGCTGTGAGCCACTGTTCAGGGG + Intergenic
1012229292 6:96741588-96741610 ACATAAGAGCTCATGTCCAGTGG + Intergenic
1014007676 6:116439722-116439744 ATATGTGAGCTGTTGTTCAGGGG + Exonic
1015896767 6:138025363-138025385 ACATATGACCTCCTGGACAGTGG + Intergenic
1018264245 6:162004490-162004512 AAATATGAACTGCTGGTCAGAGG - Intronic
1018510318 6:164517878-164517900 TCATATAAGACACTGTTCAGTGG - Intergenic
1021418636 7:20419682-20419704 AAATATGAGCTACTGCTAAAAGG + Intergenic
1021655378 7:22869119-22869141 ACATATGACCTGCTGTTCACCGG + Intergenic
1022490100 7:30810525-30810547 ACATATTAGCTACAGTTAAAGGG + Intronic
1024510153 7:50197590-50197612 ACAAATGAGCTATTTTTTAGTGG - Intergenic
1027830751 7:83174140-83174162 ACATGTGAGCCACTATTCTGAGG - Intergenic
1028460504 7:91086569-91086591 ACATATGAGATGCTATTGAGAGG + Intronic
1029858319 7:103541231-103541253 ACATGTGAGCTAGTTTTCATTGG - Intronic
1033478602 7:141715861-141715883 ACATATGTGCAACTGTTAAATGG - Intronic
1034877196 7:154735463-154735485 ACCTATGAGGTACTGTGCAATGG + Intronic
1035280441 7:157775256-157775278 TCATATGAGCTGCTCTTTAGAGG + Intronic
1035459067 7:159028362-159028384 GCACATGTGCCACTGTTCAGCGG - Exonic
1038040085 8:23716980-23717002 GCATGTGAGTTACTGTGCAGGGG + Intergenic
1039972706 8:42333908-42333930 CCATATGAGGTAATGTTCACAGG + Intergenic
1042890547 8:73604936-73604958 ACATATGAGCTACTGTGCATGGG - Intronic
1050913360 9:11101948-11101970 ACATAAGAGCTAATTTTTAGAGG + Intergenic
1052686484 9:31764251-31764273 AGATATGTGCAATTGTTCAGTGG + Intergenic
1053001641 9:34579990-34580012 GCATCTGAGCTACTGTTCACTGG + Intronic
1053439035 9:38099481-38099503 ACAAATTTGGTACTGTTCAGAGG - Intergenic
1055430437 9:76238063-76238085 ACAGATCAGCTGCTCTTCAGAGG + Intronic
1059598766 9:115752977-115752999 ACATGTGGGCTACTGTTCACAGG - Intergenic
1062434177 9:136539224-136539246 ACATGTTGGCTGCTGTTCAGAGG + Intronic
1187134733 X:16536474-16536496 AATTATCAGCTCCTGTTCAGTGG + Intergenic
1187856186 X:23637639-23637661 ACCTATGAGAAACTGCTCAGAGG - Intergenic
1188897049 X:35681584-35681606 ACATCTGTGCTACTGTGGAGAGG - Intergenic
1191918071 X:66223650-66223672 ACATATTAGCTAATGTTAAAGGG - Intronic
1192474847 X:71431560-71431582 ACATAAGAGTCACTGTTTAGAGG + Intronic
1199512011 X:148632934-148632956 ACATGTGAGTTTCTATTCAGGGG - Intronic