ID: 1120176928

View in Genome Browser
Species Human (GRCh38)
Location 14:81304411-81304433
Sequence CATCTCTAACAGCGTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120176928_1120176939 30 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176939 14:81304464-81304486 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
1120176928_1120176933 -9 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176933 14:81304425-81304447 TTAGAGATGGAATCAGGGCCGGG 0: 1
1: 0
2: 2
3: 30
4: 361
1120176928_1120176934 -4 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176934 14:81304430-81304452 GATGGAATCAGGGCCGGGCATGG 0: 1
1: 0
2: 9
3: 90
4: 740
1120176928_1120176938 27 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176938 14:81304461-81304483 GCTTGTAATCCTAGCACTTTGGG 0: 700
1: 25444
2: 253789
3: 274300
4: 170459
1120176928_1120176937 26 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176937 14:81304460-81304482 TGCTTGTAATCCTAGCACTTTGG 0: 387
1: 12756
2: 118396
3: 249307
4: 242012
1120176928_1120176932 -10 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176932 14:81304424-81304446 GTTAGAGATGGAATCAGGGCCGG 0: 1
1: 0
2: 1
3: 34
4: 348
1120176928_1120176935 -1 Left 1120176928 14:81304411-81304433 CCAAGCTCACGCTGTTAGAGATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1120176935 14:81304433-81304455 GGAATCAGGGCCGGGCATGGTGG 0: 1
1: 10
2: 115
3: 870
4: 4564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120176928 Original CRISPR CATCTCTAACAGCGTGAGCT TGG (reversed) Intronic
900940135 1:5793287-5793309 CATCTCCAACAGCCTGAGGCTGG + Intergenic
904754186 1:32759110-32759132 CATTTCTAGCAGTGTGACCTTGG + Intronic
909655354 1:78025759-78025781 CATCTCTATCTGTGTGATCTGGG - Intronic
910729433 1:90376714-90376736 CATTGCTAACAGAGTGACCTTGG - Intergenic
913351695 1:117868252-117868274 CATCTATAAAAGCATGAACTTGG + Exonic
915013853 1:152714855-152714877 CACTTCTAACTGTGTGAGCTTGG + Intergenic
915027097 1:152841356-152841378 CTGCTCTAACAGAGTGAGCGAGG + Intergenic
916495487 1:165342921-165342943 CTTCCCCAACAGCGTGACCTTGG + Intronic
918446913 1:184625891-184625913 CATCCCTAACGGCGTGTGCCTGG + Exonic
1063114291 10:3063387-3063409 AATTTCTAACAGGGTGATCTGGG + Intergenic
1064594977 10:16934818-16934840 CAGCTCCAACAGCCTGAGTTAGG + Intronic
1065251102 10:23815245-23815267 CATCTGTAAAAGTGAGAGCTTGG - Intronic
1071122456 10:82295401-82295423 AATCTCTAACAGTATGACCTCGG + Intronic
1071975049 10:90947236-90947258 CAGCTCTAACAATGAGAGCTAGG + Intergenic
1074386769 10:113022841-113022863 CATCTCAAAGTGGGTGAGCTTGG - Intronic
1077306714 11:1871868-1871890 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306740 11:1871962-1871984 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306811 11:1872244-1872266 CAACTCTACCAGCGTGTGCCAGG - Intronic
1077306835 11:1872338-1872360 CAACTCTACCAGCATGGGCTGGG - Intronic
1085691135 11:78664627-78664649 CCTCTCTAACAGAAGGAGCTTGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089221639 11:116876914-116876936 CAACTTTGACAGGGTGAGCTGGG - Exonic
1089353223 11:117833275-117833297 CTGCTCTAACAGTGTGAGCTTGG - Intronic
1089525069 11:119091914-119091936 CACCTCTAACACCGTAGGCTGGG + Intronic
1090660455 11:128878456-128878478 CATCTCTGGCAGAGTGAGCAGGG + Intergenic
1095347669 12:41170700-41170722 TGTCTCTAACAGCGTGTCCTTGG - Intergenic
1096436754 12:51597536-51597558 CATTTCTACCAGCGTGAACTTGG + Intronic
1096585939 12:52619701-52619723 CATCTCCAAAATTGTGAGCTAGG - Intergenic
1097716501 12:62971944-62971966 CCTCTCTCTCAGCATGAGCTAGG - Intergenic
1110898686 13:80791943-80791965 CCTATCTGACAGCTTGAGCTGGG + Intergenic
1112464630 13:99632817-99632839 CATCTCTATCATCTTGAGTTTGG - Intronic
1113709514 13:112454309-112454331 CCTCTCCCACAGCATGAGCTGGG + Intergenic
1115239967 14:31244327-31244349 CATATCTAACAGCGCGATCCCGG + Intergenic
1120176928 14:81304411-81304433 CATCTCTAACAGCGTGAGCTTGG - Intronic
1123498907 15:20861340-20861362 CAACTATATCAGCGTGAGATGGG - Intronic
1123556143 15:21434959-21434981 CAACTATATCAGCGTGAGATGGG - Intronic
1123592383 15:21872305-21872327 CAACTATATCAGCGTGAGATGGG - Intergenic
1124484129 15:30100838-30100860 CATGTCTACCAGCGTGGGCACGG + Intergenic
1124519453 15:30396386-30396408 CATGTCTACCAGCGTGGGCACGG - Intergenic
1124539202 15:30569835-30569857 CATGTCTACCAGCGTGGGCACGG + Intergenic
1124588809 15:31035566-31035588 CATCTCCTACATCGTGAGCCTGG - Exonic
1124759448 15:32437737-32437759 CATGTCTACCAGCGTGGGCACGG - Intergenic
1127259820 15:57319638-57319660 CATCTCTCACAGCAGGAGCAGGG - Intergenic
1131853030 15:96563147-96563169 CATCTCTGACAGTAAGAGCTAGG + Intergenic
1132227423 15:100153336-100153358 CGTCTCTAAAAGAGTGAACTGGG + Intronic
1202964484 15_KI270727v1_random:162162-162184 CAACTATATCAGCGTGAGATGGG - Intergenic
1138639950 16:58377468-58377490 GATCTCAAACAGCCTGAGCCTGG - Intronic
1139296143 16:65902791-65902813 CCTCTCTCTCAGCTTGAGCTGGG + Intergenic
1140759853 16:78100630-78100652 CATCTTTAACTGTGTGACCTTGG + Intronic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142528260 17:560455-560477 CATCTGTAACATCCTGAGCACGG - Exonic
1142968411 17:3595297-3595319 CATCTCTGACTGTGTGACCTCGG - Intronic
1143792703 17:9310760-9310782 CAGCTCTAACATCGAGACCTTGG - Intronic
1143877280 17:10001599-10001621 CATCTCTAAAAGAGAGAGTTGGG - Intronic
1147622649 17:41878066-41878088 TGTCTCTAACAGTGTGAGCAAGG - Intronic
1154456950 18:14538100-14538122 CAACTATATCAGCGTGAGATGGG - Intronic
1155157596 18:23170487-23170509 CATCTCCAGCAGCGTGTGCATGG + Intronic
1156336187 18:36173946-36173968 GACCTCTAACTGCGTGACCTTGG - Intronic
1160201640 18:76801458-76801480 CATCTCTAAAAACATTAGCTGGG + Intronic
1162261328 19:9536715-9536737 CCTCTCTGACAGTGTGAGCTGGG - Intronic
1162870688 19:13584263-13584285 CAGCTCTAACAGGATGAGCTGGG + Intronic
1165098414 19:33423304-33423326 CATCTCTAACAGCAGGAAGTTGG - Intronic
1166846746 19:45733292-45733314 CGTCTTGCACAGCGTGAGCTCGG - Exonic
1166849906 19:45754671-45754693 CAGATCCAACAGCGTCAGCTGGG - Exonic
1168235097 19:55057942-55057964 CATCTCTACCAGAGTTAGCCAGG - Intronic
929140674 2:38663886-38663908 CTTCTGTAACAGCATGTGCTTGG + Intergenic
936264361 2:110990506-110990528 CATGTCTCACAGCAAGAGCTAGG + Intronic
937719526 2:125077751-125077773 CATCACTAAGAGGATGAGCTAGG - Intergenic
938474638 2:131596901-131596923 CAACTCTATCAGCGTGAGGTGGG + Intergenic
943143183 2:184008937-184008959 CATTTGTACCAGAGTGAGCTGGG + Intergenic
944370336 2:198974676-198974698 CATCTTTGACAGAGTCAGCTGGG - Intergenic
944470965 2:200053930-200053952 CCTCTCAAACAGCCTGACCTGGG - Intergenic
945865465 2:215169554-215169576 GATCTCTAGAAGCGAGAGCTTGG + Intergenic
947579297 2:231303466-231303488 CATCTAGTACAGCGTTAGCTGGG + Intronic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1172421777 20:34824918-34824940 CAGCCCTGACAGCCTGAGCTTGG + Intronic
1172731820 20:37095291-37095313 CATCTCTAACCGTGTGACCTTGG + Intronic
1176817210 21:13615250-13615272 CAACTATATCAGCGTGAGATGGG + Intronic
1179725638 21:43339969-43339991 CATCTCCGTCAGCGAGAGCTGGG + Intergenic
1179815768 21:43905021-43905043 CATCTCTGAAAGCCCGAGCTTGG - Intronic
958109029 3:89115092-89115114 CATCTCTTACTGGGTGCGCTTGG + Intronic
973117259 4:46477198-46477220 CATGGTTAACAGCTTGAGCTTGG - Intergenic
977265065 4:94844305-94844327 TATCTGTAACAGAGGGAGCTGGG - Intronic
982739048 4:159038889-159038911 CATCACTAGGAGGGTGAGCTGGG + Intergenic
983750349 4:171260553-171260575 CATCTACAACAGTGTGATCTTGG - Intergenic
990635406 5:57720702-57720724 CATCTCTAACAAAATGAGCTTGG - Intergenic
990776914 5:59313474-59313496 CATCTCTAAAACCCTGAGGTAGG - Intronic
994371989 5:98977951-98977973 CATATCTAACAGGGTGAGCCTGG - Intergenic
1006636184 6:35462874-35462896 CATCACTGTCAGCATGAGCTTGG - Exonic
1007003035 6:38333026-38333048 CATCTCTAATGGCATGAGGTAGG + Intronic
1008559003 6:52704934-52704956 CACCTCTGACAGCATGATCTTGG - Intergenic
1014032845 6:116726485-116726507 CATCTATAACAGCCTGAGAGGGG - Exonic
1022727324 7:32992780-32992802 AATCCCTAACACCGTGAGCAGGG - Intronic
1024612913 7:51082469-51082491 CATCTCAAACAGGGTGTGCCAGG + Intronic
1048243865 8:132772395-132772417 CATCTGGAACAGGGTGTGCTGGG + Intergenic
1053239406 9:36484359-36484381 CATGTCTAACAGGCTGCGCTAGG + Intronic
1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG + Intergenic
1203530153 Un_GL000213v1:134241-134263 CAACTATATCAGCGTGAGATGGG - Intergenic
1194482898 X:94448699-94448721 CATCTATGACTGCTTGAGCTAGG + Intergenic
1194663234 X:96649074-96649096 CATCTCCAAGAGGGGGAGCTAGG + Intergenic
1197563455 X:128051914-128051936 CATCTCTTTGAGCGGGAGCTTGG - Exonic