ID: 1120177448

View in Genome Browser
Species Human (GRCh38)
Location 14:81310038-81310060
Sequence TTTCCACACTTTAAAGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120177443_1120177448 -10 Left 1120177443 14:81310025-81310047 CCCCAGGAATCAATTTCCACACT 0: 1
1: 0
2: 2
3: 11
4: 213
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1120177437_1120177448 28 Left 1120177437 14:81309987-81310009 CCTCCCCTTCTGCCACTCAGAAA 0: 1
1: 0
2: 1
3: 22
4: 338
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1120177440_1120177448 23 Left 1120177440 14:81309992-81310014 CCTTCTGCCACTCAGAAAATTCA 0: 1
1: 0
2: 1
3: 18
4: 310
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1120177441_1120177448 16 Left 1120177441 14:81309999-81310021 CCACTCAGAAAATTCATTATTTA 0: 1
1: 0
2: 3
3: 42
4: 577
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1120177439_1120177448 24 Left 1120177439 14:81309991-81310013 CCCTTCTGCCACTCAGAAAATTC 0: 1
1: 0
2: 3
3: 27
4: 254
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1120177438_1120177448 25 Left 1120177438 14:81309990-81310012 CCCCTTCTGCCACTCAGAAAATT 0: 1
1: 0
2: 2
3: 33
4: 325
Right 1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120177448 Original CRISPR TTTCCACACTTTAAAGTGAG GGG Intronic
903215760 1:21842541-21842563 TTCCTCCACTGTAAAGTGAGTGG - Intronic
904487316 1:30835390-30835412 TTTCCACACTGTAAAATCAAGGG - Intergenic
905943729 1:41884662-41884684 TTTCCTCATTTGCAAGTGAGGGG - Intronic
907791176 1:57666127-57666149 TTACCAGACTTTAAATTGATTGG - Intronic
910134428 1:83950647-83950669 ATTCCACACTTGAAATTCAGTGG - Intronic
913612843 1:120525029-120525051 TTTCTACACTTTTAAGAGCGTGG - Intergenic
914220309 1:145675583-145675605 TTTCCATATTTTAAAGAGAAAGG - Intronic
914472887 1:147998445-147998467 TTTCCATATTTTAAAGAGAAAGG - Intergenic
914578346 1:148997218-148997240 TTTCTACACTTTTAAGAGCGTGG + Intronic
915249272 1:154576918-154576940 TTTCCCCACTTTGAACTGACTGG + Exonic
915954988 1:160213810-160213832 CTTCCACACTTTAAAGATATGGG - Exonic
917793010 1:178511919-178511941 TTTCCCCACTTATAAATGAGGGG - Intergenic
918195032 1:182213309-182213331 TTTCCTCATTTTGAAGTGAGGGG - Intergenic
918528561 1:185491316-185491338 TTTCAATACTTTCAAGTGTGTGG + Intergenic
918847031 1:189629110-189629132 GTCCCACCCTTGAAAGTGAGGGG - Intergenic
920700075 1:208211304-208211326 TTTCCAGCCTTTAAGGAGAGTGG + Intronic
920873555 1:209814118-209814140 TTTCTCCTCTTTACAGTGAGGGG + Intergenic
920985228 1:210882575-210882597 GTTCCATACTTTAAAGTAAAGGG - Intronic
921940416 1:220833086-220833108 TTCCTTCACTGTAAAGTGAGAGG + Intergenic
922109178 1:222540810-222540832 TTTCCTCATTTGAAAGTCAGAGG + Intronic
923082643 1:230673210-230673232 TTTCCACAGTTTTTAGTGTGGGG + Intronic
923494814 1:234514679-234514701 TTTCCCAACTGTAAAATGAGGGG - Intergenic
924376287 1:243412850-243412872 TTTTCCAACTGTAAAGTGAGAGG + Intronic
1064027880 10:11863307-11863329 TTTCCACACTGTGATCTGAGAGG - Intronic
1066449673 10:35517260-35517282 TTTCCGTACTTTAAAGAGGGAGG + Intronic
1068361536 10:55979742-55979764 TTTCCTCTCTTCAAAGAGAGAGG + Intergenic
1069861775 10:71475957-71475979 TTTCCACTCTTCAAAGCAAGGGG + Intronic
1070397067 10:76020557-76020579 TGTCCTCACCTTAGAGTGAGGGG - Intronic
1070638073 10:78145246-78145268 TCTCCACACTTGCAAATGAGAGG - Intergenic
1074109735 10:110414406-110414428 CTTCCAGACCTTAAAGAGAGAGG - Intergenic
1074757409 10:116634782-116634804 TGTTCACACTTAAAAGTGAAAGG + Intronic
1074941435 10:118239611-118239633 TTTCCACTTTTAAAAGTCAGCGG - Intergenic
1078257175 11:9668191-9668213 TTTTCACACTTTAAAGCCAATGG + Intronic
1078306391 11:10192009-10192031 TCTCCACACTTTGATGTGAATGG + Intronic
1081556243 11:44164816-44164838 CTTCCACAGTTTAGAGTGACTGG + Intronic
1081622217 11:44625294-44625316 TTTCCACACTGTAAAGGGGTGGG - Intergenic
1082092225 11:48099286-48099308 TTTCCACATTTTTAAATGGGTGG + Intronic
1085584497 11:77688949-77688971 TTTGCACAAGGTAAAGTGAGAGG + Intronic
1085786693 11:79457891-79457913 TTTTCTCACTGTAAAGTGAAGGG + Intergenic
1086502236 11:87465300-87465322 TTTCCAGCCTCTAAAGTGAAAGG + Intergenic
1091252798 11:134157951-134157973 CTTCCAGAATTTAAAGTGAAAGG + Exonic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091986783 12:4916087-4916109 TTTCAACACATTACAGTGCGAGG - Exonic
1093117418 12:15228233-15228255 TTTCCACAGTTTCTATTGAGAGG - Intronic
1093595900 12:20959076-20959098 TTTCCACAATTTAAAGTACTTGG - Intergenic
1094816418 12:34190587-34190609 TTTCCTCATTTTACAGTGTGTGG + Intergenic
1099237562 12:80099889-80099911 TTTCCTCTCTTCAAAGTGATTGG - Intergenic
1099755178 12:86837137-86837159 TTTTAATGCTTTAAAGTGAGTGG + Intronic
1102516231 12:113448701-113448723 TTGCCCCACTTTGAAATGAGGGG - Intergenic
1104558867 12:129825756-129825778 GGCCCACACTTTAAAGCGAGGGG + Intronic
1105954231 13:25264928-25264950 TTTCCCCACTTGAAAGTTACAGG + Intronic
1106580066 13:31010123-31010145 TTTCCCCACTGTAAAGGAAGGGG + Intergenic
1107591360 13:41910076-41910098 ATTCCACAATTTAAAGTTGGGGG + Intronic
1109007017 13:56890736-56890758 ATTAAACACTCTAAAGTGAGTGG - Intergenic
1111091144 13:83449689-83449711 TTACCACACTTAAAAATCAGTGG - Intergenic
1111560229 13:89935110-89935132 TTTCCAGTCTTTCAAATGAGTGG + Intergenic
1112183959 13:97110794-97110816 ATCTCACACTTTAAAGTGTGTGG - Intergenic
1112885011 13:104159392-104159414 TTTGGTCATTTTAAAGTGAGTGG - Intergenic
1113136504 13:107096136-107096158 TTTCCAAATTTTAAAGTGAATGG - Intergenic
1113225560 13:108155571-108155593 TTTCCACTCTTTAATGTAAAAGG - Intergenic
1114187901 14:20417072-20417094 TTCTCAAACTTTAATGTGAGTGG - Intergenic
1114216663 14:20662317-20662339 TTTGCAGACTTTGAACTGAGTGG + Intergenic
1114397322 14:22377522-22377544 TTTCAAAACTTTAAAAGGAGAGG - Intergenic
1114818651 14:25989846-25989868 TTTTAACACTTTAAAGTCAATGG + Intergenic
1115053881 14:29098703-29098725 TTTTCAAACTTTAATTTGAGAGG - Intergenic
1116562840 14:46403095-46403117 TTTCCCCAGTTTAAAGTGATTGG - Intergenic
1117489413 14:56231138-56231160 CTTCCACACAGTAAAGTGGGGGG + Intronic
1119717439 14:76868865-76868887 TCTCCTCATTTTAAAGGGAGAGG - Intronic
1120025707 14:79581672-79581694 TTTTCAGAATTTAAAGTAAGGGG - Intronic
1120177448 14:81310038-81310060 TTTCCACACTTTAAAGTGAGGGG + Intronic
1120601605 14:86517175-86517197 TTTCCACATTTTAACTTGAAAGG + Intergenic
1121155193 14:91676417-91676439 TGTGCACATTTTAAACTGAGGGG + Intronic
1121603605 14:95224584-95224606 TTTCCCCAATCTAAAGTGAAGGG - Intronic
1123583144 15:21733979-21734001 GTTCCTCACTTTGCAGTGAGTGG + Intergenic
1123619794 15:22176576-22176598 GTTCCTCACTTTGCAGTGAGTGG + Intergenic
1124053144 15:26217681-26217703 TTTCTATTCTGTAAAGTGAGGGG + Intergenic
1124721699 15:32116306-32116328 TTTCCATGCTTTAAAGTGGCTGG + Intronic
1124847311 15:33303861-33303883 TTTCCTCATCTTAGAGTGAGGGG + Intergenic
1125119533 15:36137934-36137956 TTTTCTCACTTATAAGTGAGAGG - Intergenic
1125457855 15:39879150-39879172 TTTCCTTATTTTTAAGTGAGGGG - Intronic
1125845908 15:42853453-42853475 TTTCCATCATCTAAAGTGAGTGG - Intronic
1126896179 15:53259124-53259146 TTTCCTCTCCTTAAAGTTAGTGG + Intergenic
1127108325 15:55641604-55641626 TTTCCATACTTTGAAGTAAACGG - Intronic
1127927599 15:63561977-63561999 TTTCCTCACATAAAAGTCAGAGG + Intronic
1128163058 15:65437234-65437256 TTTCCTCATCTGAAAGTGAGGGG + Intergenic
1128306999 15:66605286-66605308 TTTCCCAACTATAAAATGAGAGG + Intronic
1129754058 15:78085370-78085392 TTTCCCAGCTGTAAAGTGAGGGG + Intronic
1130399624 15:83537283-83537305 TACCCACACTCTAAAGAGAGTGG - Intronic
1130548371 15:84872865-84872887 TTTCCAGACCTTAAATGGAGAGG - Exonic
1134208178 16:12254313-12254335 TTTCCACATCTTAATGTGGGAGG - Intronic
1136679946 16:31954056-31954078 ATTCCTCACTTTAAAGTGGATGG - Intergenic
1136780292 16:32895600-32895622 ATTCCTCACTTTAAAGTGGATGG - Intergenic
1136890116 16:33964044-33964066 ATTCCTCACTTTAAAGTGGATGG + Intergenic
1140148396 16:72335438-72335460 TTTCCCCACTATAAATTGATAGG - Intergenic
1203082916 16_KI270728v1_random:1159570-1159592 ATTCCTCACTTTAAAGTGGATGG - Intergenic
1142897853 17:2993727-2993749 TTTTCACATTTTAAAGTCACAGG - Intronic
1143245814 17:5485143-5485165 TTTAAACACTTTCAAGTAAGTGG - Exonic
1143303255 17:5926697-5926719 TATCCTCACTTTATAGTGGGTGG + Intronic
1143444615 17:7000162-7000184 TTTCTTCACTTTAAGATGAGAGG + Intronic
1147652355 17:42069739-42069761 TTTCCTGTCTTTAAAGAGAGGGG + Intergenic
1147928545 17:43961400-43961422 TTTCCAACTTTTAAATTGAGGGG - Intronic
1148350810 17:46940704-46940726 TTTCCACACTTGACAGTGGTTGG + Exonic
1149019229 17:51944163-51944185 TTCCCACATTTTAAAATGAACGG + Intronic
1149474223 17:56945693-56945715 TTTCCACAATTTACAGTTTGGGG + Intronic
1149685706 17:58533355-58533377 TTTCCATACCTGAAAATGAGGGG + Intronic
1150977135 17:70100752-70100774 TTTCTTACCTTTAAAGTGAGAGG - Exonic
1153456082 18:5283399-5283421 TTGCCAGAGTTTAAAGTGGGAGG - Intergenic
1156183449 18:34633630-34633652 ATACCATACTTAAAAGTGAGAGG - Intronic
1156640648 18:39092934-39092956 TTTGCACAATTTAAAATGAATGG + Intergenic
1158728061 18:59992929-59992951 TTTCAAGACTGTAAAATGAGAGG - Intergenic
1160483285 18:79262608-79262630 TTTCCAGATTTTAAGGTCAGTGG + Intronic
1162435536 19:10655618-10655640 TTTGCTCTCTTTAAAATGAGTGG + Intronic
1163733101 19:18961605-18961627 TTTCCCCTCTCTACAGTGAGTGG - Intergenic
1163978616 19:20876779-20876801 TTTTCACACTTGTGAGTGAGTGG - Intergenic
1164724575 19:30457589-30457611 TCTCCACACCAGAAAGTGAGAGG + Intronic
1165636793 19:37347121-37347143 CTCCCACACTTTAGAATGAGAGG - Intronic
925150047 2:1609222-1609244 TTTCCACACTCTACAGGAAGTGG - Intergenic
926988059 2:18645711-18645733 TTTGCACACTTTACAGTGATTGG - Intergenic
927324159 2:21783903-21783925 TTTTAACACTTCCAAGTGAGTGG - Intergenic
927385820 2:22532797-22532819 TTTCGGCACTTTACAGTCAGAGG - Intergenic
928776869 2:34776114-34776136 TTTCCACATTTTATACTGTGTGG + Intergenic
930849382 2:55942348-55942370 TTTTCAGACTTTAAAATCAGTGG + Intergenic
931053547 2:58441414-58441436 TTTCTTAACTTTAAAGTGAAGGG + Intergenic
932065338 2:68552018-68552040 TTTCCCGACTTTTATGTGAGAGG + Intronic
932110586 2:68995514-68995536 CTTCCCCACTTTGAAGTGAAAGG - Intergenic
933366149 2:81356919-81356941 TTTCCTAAATTTCAAGTGAGGGG - Intergenic
934568581 2:95354094-95354116 TTTCCTCACCTGTAAGTGAGGGG + Intronic
935274760 2:101466569-101466591 TGTCCACACTTCATAGTGAGGGG - Intronic
938492312 2:131768031-131768053 TTTCAACACTTGAATTTGAGGGG + Intergenic
938495257 2:131794319-131794341 TTTCAACACTTGAATTTGAGGGG - Intergenic
941134186 2:161693172-161693194 TTTCAAAACTTTAAAGGGAAAGG + Intronic
941930440 2:170933697-170933719 GTTCCACACTTAAAAGAGATGGG + Intronic
948553304 2:238790585-238790607 ATTCCAGACTTTAAAGGGAAAGG + Intergenic
1168913034 20:1465411-1465433 TTTCCCCACTACAATGTGAGGGG + Intronic
1171820091 20:29828138-29828160 TTTCCTCATTTTACAGTGTGTGG + Intergenic
1171822384 20:29865269-29865291 TTTCCTCATTTTACAGTGTGTGG + Intergenic
1175398329 20:58683463-58683485 TTTCCCCCCTTTTAAATGAGAGG - Intronic
1177214449 21:18110306-18110328 TTGCCACACTTTTCATTGAGAGG + Intronic
1179832715 21:44007806-44007828 GTTCCACACTTCACAGTGTGAGG + Intergenic
1180324088 22:11352826-11352848 TTTCCTCATTTTACAGTGTGTGG + Intergenic
1180598069 22:16992399-16992421 TTTCCACACTTTAGAGCAGGAGG + Intronic
1181294382 22:21823723-21823745 ATTCCCCAGTTTAAAGTGAAAGG - Intronic
1181446263 22:22977284-22977306 TTTCCAAACCTTAAAATGATTGG + Intergenic
1181577641 22:23805465-23805487 TTTCAACCCTTTAAGGTCAGGGG + Intronic
1181909889 22:26230243-26230265 TTCCCAAATTGTAAAGTGAGGGG - Intronic
1181978520 22:26749818-26749840 ATTCCACACTTACAAGTGATAGG - Intergenic
1182048486 22:27295656-27295678 TTTGCAGACTTCAGAGTGAGTGG - Intergenic
1182551525 22:31103443-31103465 TTTCCCCACTCTGGAGTGAGTGG - Intronic
1182680618 22:32076616-32076638 TTTCCACTTGTGAAAGTGAGTGG - Intronic
1182801760 22:33037358-33037380 TTTCCTCATTTGAAATTGAGGGG + Intronic
1182891265 22:33820625-33820647 CTCCAACACTTTAAAATGAGAGG - Intronic
1184385084 22:44169505-44169527 TTTGGAAACTTTAAAATGAGGGG + Intronic
1184895073 22:47401903-47401925 TGTCCAATCTTTATAGTGAGTGG - Intergenic
952758222 3:36890954-36890976 TTTCCTCACTTGAAACTGGGAGG + Intronic
953192432 3:40700544-40700566 TTCTCACAGTTTAATGTGAGGGG - Intergenic
953266827 3:41398153-41398175 TTTCCACATTTTCAGGAGAGAGG + Exonic
954055171 3:48017118-48017140 TTTCCATCTATTAAAGTGAGGGG - Intronic
954430966 3:50470684-50470706 TTCCCAGACTTTACAGTGGGCGG + Intronic
954838278 3:53490345-53490367 TGACCACAGTTTAAAGTGAATGG + Intergenic
955548860 3:60061095-60061117 TTTGCACTCTTGAAAGTGACAGG - Intronic
956600881 3:71021007-71021029 TTTCCACAATTTTGAGTGAGTGG - Intronic
957086839 3:75687694-75687716 TTTCCTCATTTTACAGTGTGTGG - Intergenic
957547624 3:81660738-81660760 TTTCTTCAATTTAAAGTGTGTGG - Intronic
958433415 3:94068976-94068998 TTTAGACACTTTAAAGTCAGAGG + Intronic
958555287 3:95666855-95666877 TTTCCACACTGTTAACTGAGAGG + Intergenic
958750010 3:98184406-98184428 TTTCCTAACTTTCAGGTGAGTGG - Intronic
960519995 3:118643721-118643743 TGGCCAGACTTTAGAGTGAGTGG - Intergenic
963917070 3:150868450-150868472 TTTCCACAGTGTGAAGTGAAGGG + Intergenic
964879770 3:161410384-161410406 TTTCATCACTTTAATGTCAGTGG - Intergenic
965334022 3:167412797-167412819 TTTCCACACTTAAAAATTACTGG + Intergenic
965500942 3:169456030-169456052 TGTCAACACTTAAAAGTGAGAGG + Intronic
967223150 3:187266273-187266295 TGTCTACACTTTAATGTGAAGGG + Intronic
969389739 4:6882603-6882625 TTTTGACACTTTAAGGTGGGTGG + Exonic
971574121 4:28252300-28252322 TTACCACATTTTGAAGAGAGAGG - Intergenic
971992870 4:33923905-33923927 TTACCTCTCTTTAGAGTGAGAGG - Intergenic
972180835 4:36463216-36463238 CCTGCCCACTTTAAAGTGAGTGG + Intergenic
972672887 4:41230921-41230943 TTTCAACACATTGAAGTGACAGG + Intergenic
973707448 4:53594376-53594398 TTTTCAGATTTTAAAGTGATAGG - Intronic
973788810 4:54359772-54359794 TATCCACACTTTAGTCTGAGGGG + Intergenic
974346947 4:60694554-60694576 TATCCACAGTTAAAAGTGAGTGG - Intergenic
974984294 4:69000300-69000322 TTGCCAAACTTCAAAGGGAGGGG + Intergenic
974987640 4:69049350-69049372 TTGCCAAACTTCAAAGGGAGGGG - Intronic
974993157 4:69119400-69119422 TTGCCAAACTTCAAAGGGAGGGG - Intronic
975385448 4:73754096-73754118 TTTTCTCACTGTAAAGTGAGGGG - Intergenic
975545892 4:75560178-75560200 TGTACAGACTTTAAAGAGAGAGG + Intronic
977095719 4:92741195-92741217 TTTCCCCATTTTACAGTGAAAGG - Intronic
977668332 4:99667172-99667194 TTTCTTATCTTTAAAGTGAGTGG - Intergenic
979904459 4:126269087-126269109 TTTCCACTCTTTAGAGTGTGAGG + Intergenic
980881929 4:138719289-138719311 TTTCCTCACTGTAAGGTGAGGGG - Intergenic
981198354 4:141946907-141946929 TATCCTCACTTATAAGTGAGAGG + Intergenic
982432966 4:155344169-155344191 TACCTACACTTTAAAGTGAGGGG - Exonic
983280001 4:165668517-165668539 TTTTCAGATTTTAAAGTTAGTGG + Intergenic
987170168 5:15247239-15247261 TTTCTCGACTTTAAAGTGAGAGG + Intergenic
987221623 5:15796267-15796289 TTTCCACCCTCTAATGTTAGAGG - Intronic
988363242 5:30263291-30263313 GTTCAACACTTTGAAGTGAAAGG + Intergenic
989230356 5:39078982-39079004 TTCACACACTTTGAAATGAGAGG - Intergenic
991946470 5:71902701-71902723 CTTCCAGATTTTAATGTGAGAGG - Intergenic
993850745 5:93005024-93005046 TTTCCTGTCTTTAAAATGAGAGG - Intergenic
993876359 5:93311680-93311702 TTTCCAAAGTATAAAATGAGGGG + Intergenic
994000429 5:94772942-94772964 TCTCCTCACTTTAAATTAAGTGG + Intronic
994297307 5:98106076-98106098 TTTCAACACTGGAAAATGAGGGG - Intergenic
996926880 5:128837924-128837946 CTCCCACAATTTAAAGTGGGGGG - Intronic
997436775 5:133881396-133881418 TTTCCAGACTTTGAAGAGGGAGG - Intergenic
998533747 5:142909912-142909934 TTATCACACTTGAAAGTGAAGGG + Intronic
999678582 5:154032636-154032658 TTTCCCCTCTTTAAAGAAAGAGG + Intronic
999716761 5:154367384-154367406 TTTTCTCACTTGAAGGTGAGAGG + Intronic
1000005552 5:157180428-157180450 TTTCTTCACTTTAATGTGTGAGG + Intronic
1000605598 5:163324317-163324339 TTCCTACACATTAAAGAGAGTGG - Intergenic
1001510732 5:172319620-172319642 TTCCCACACTTTAAAATCACTGG - Intergenic
1002930623 6:1632232-1632254 TTTACACACATTAATTTGAGTGG + Intronic
1003010842 6:2426040-2426062 CCTCCACACATTACAGTGAGAGG - Intergenic
1003306095 6:4930941-4930963 TTTCCACAGTTTGGGGTGAGGGG + Intronic
1005750401 6:28876541-28876563 TTGCCTCACTTTAGAGTAAGGGG - Intergenic
1006963550 6:37958868-37958890 TTTCCAAACTTTAAGATGACTGG + Intronic
1007271247 6:40638899-40638921 TTTCCACACTTGAATGTGAGTGG + Intergenic
1008639233 6:53444412-53444434 TGGCTTCACTTTAAAGTGAGTGG - Intergenic
1011215991 6:85006089-85006111 TTTGCACAATTTAAAATAAGGGG - Intergenic
1014119814 6:117712125-117712147 TTTCCACAGTTTAATGAGACAGG + Intergenic
1014588498 6:123231668-123231690 TTTCCAAACTTTAAAATGATTGG - Intronic
1014830174 6:126093948-126093970 TTTCCACAGTATAATGTGAGTGG + Intergenic
1015102516 6:129498178-129498200 TTTTCACATTTTAAACTGTGAGG - Intronic
1015169264 6:130233051-130233073 TTTCCAAACTTCAAAGTCTGAGG + Intronic
1016575071 6:145561062-145561084 TTTCCACACCCTAAATTGTGTGG + Intronic
1017781710 6:157720573-157720595 TATCCACACTTCAGAGGGAGAGG - Intronic
1023706182 7:42943932-42943954 TTTGGTCACTTTAAAGTGTGTGG + Intronic
1024887932 7:54166452-54166474 TGTGCACATTTTAAACTGAGGGG - Intergenic
1027008172 7:74715767-74715789 TTTTCACAATATAAAGTAAGTGG + Intronic
1028579311 7:92388940-92388962 TGTCCACAGTATAAATTGAGAGG + Intronic
1029020041 7:97355723-97355745 TTTCCACAGTCTAAAATGAAAGG - Intergenic
1029224343 7:99014143-99014165 GTTCCCCACTTTATAGAGAGGGG + Intergenic
1030270592 7:107664654-107664676 TTCCCACACATTAAAATAAGAGG - Intronic
1030799846 7:113836168-113836190 TTGCTACACTTTAAAGCAAGTGG - Intergenic
1030939190 7:115624246-115624268 TTTATACACTTTAAAATTAGAGG + Intergenic
1031647796 7:124248178-124248200 TTTGCCCACTTTTAAATGAGTGG + Intergenic
1031822833 7:126525981-126526003 TTTCCACACTTTAAGGTAGGTGG + Intronic
1032403051 7:131637201-131637223 TTTCCCAACTCTAAAATGAGGGG - Intergenic
1032480697 7:132244523-132244545 TGTCCACACTTTAAAAAGAGTGG - Intronic
1032491965 7:132330530-132330552 TTTTCACATTTTAAAGTGTGCGG - Intronic
1034819432 7:154203093-154203115 TATCCCCATTTTCAAGTGAGTGG - Intronic
1036947098 8:13104869-13104891 TCTGCACACTTTAAAATGAGTGG + Intronic
1036984374 8:13510685-13510707 TTTCCACATTTTAAATGGGGTGG - Intronic
1037338172 8:17812405-17812427 TTTGCACACTCCAAAGTCAGGGG - Intergenic
1037459378 8:19093978-19094000 GTTCCACACCATGAAGTGAGTGG + Intergenic
1037876333 8:22550672-22550694 TTTCCAAACTTTGAGTTGAGTGG + Intronic
1037934815 8:22908511-22908533 TTTCCTCACCTTAAAATGGGTGG - Intronic
1038088947 8:24232185-24232207 TTTCCTCACTTTGAAGTCAAGGG + Intergenic
1043508489 8:80926213-80926235 TTTCCAAACTTCCAAGTCAGAGG + Intergenic
1045012622 8:97971387-97971409 TTTCCACACATTTGAGTAAGTGG + Intronic
1046816366 8:118588439-118588461 TTTTTACATTTTAAAGTGATTGG + Intronic
1047366672 8:124217607-124217629 TTTTCTCACTGTAAAATGAGAGG + Intergenic
1047625141 8:126648617-126648639 TTTGCACATTTTTTAGTGAGCGG + Intergenic
1048176721 8:132159403-132159425 TTTCCACCTGTTAGAGTGAGTGG - Intronic
1048217256 8:132507725-132507747 TTCCAGCACTTTTAAGTGAGAGG - Intergenic
1049031105 8:140038407-140038429 TTTCCACCCTCTAGAGTGAGGGG - Intronic
1050019006 9:1264477-1264499 TTTCAACAGTTTAAAGTGGCTGG + Intergenic
1050260262 9:3834256-3834278 TTTCCAAACTAGAAAGGGAGTGG + Intronic
1050732681 9:8727428-8727450 TTTAGCTACTTTAAAGTGAGGGG + Intronic
1051835935 9:21337617-21337639 TTTTCAAAATATAAAGTGAGGGG - Intergenic
1053646567 9:40123364-40123386 TTTCAACACTTGAATTTGAGAGG + Intergenic
1053759147 9:41340187-41340209 TTTCAACACTTGAATTTGAGAGG - Intergenic
1054327581 9:63721266-63721288 TTTCAACACTTGAATTTGAGGGG + Intergenic
1054538003 9:66252609-66252631 TTTCAACACTTGAATTTGAGAGG - Intergenic
1055023793 9:71697728-71697750 TTTCCACAGTTTAAAATTAGAGG - Intronic
1060232365 9:121835093-121835115 CTTCCCCTCTGTAAAGTGAGGGG + Intronic
1060403256 9:123360547-123360569 TTCCCACACCTAAAAGTGAAAGG + Intronic
1060485337 9:124042818-124042840 TTTCCCCACTGTAAAATGACAGG + Intergenic
1186642885 X:11474623-11474645 ATGCCACACTTTAAAATGAAAGG - Intronic
1188400914 X:29742991-29743013 TTAACACACTTTCAAGTGAAGGG - Intronic
1188763254 X:34057839-34057861 TTTCCAAACTTTAAACTGGTTGG + Intergenic
1189153405 X:38730362-38730384 TTTCCAAACTTTAAACTGGTTGG + Intergenic
1189552279 X:42105655-42105677 TTTTCCCACTTAAAAGTGGGTGG - Intergenic
1191603694 X:63039495-63039517 TTTGCACACTGTAAAATGAAAGG - Intergenic
1194130529 X:90075121-90075143 TTTTTAAACTTTAAACTGAGTGG - Intergenic
1194361207 X:92952700-92952722 GTTCCACACTTTAAGGGAAGGGG - Intergenic
1197211178 X:123829311-123829333 TTTCTACATTTTAAAATCAGGGG + Intergenic
1197310785 X:124902739-124902761 TTTCTTTACTTTAAATTGAGTGG - Intronic
1198504080 X:137283629-137283651 TTTCCTATCTATAAAGTGAGGGG + Intergenic
1199578826 X:149341212-149341234 TTTCTAAACTATAAAGTGAACGG + Intergenic
1199710093 X:150462875-150462897 TTTCCCCACTGTAAAGTGAATGG - Intronic
1200669404 Y:6068530-6068552 GTTCCACACTTTAAGGGAAGGGG - Intergenic