ID: 1120178973

View in Genome Browser
Species Human (GRCh38)
Location 14:81324080-81324102
Sequence AGGGTGGCGAGGGGTCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 434}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120178955_1120178973 19 Left 1120178955 14:81324038-81324060 CCGGACCCTCGCCGGGGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178954_1120178973 22 Left 1120178954 14:81324035-81324057 CCTCCGGACCCTCGCCGGGGTTC 0: 1
1: 0
2: 2
3: 2
4: 62
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178950_1120178973 25 Left 1120178950 14:81324032-81324054 CCCCCTCCGGACCCTCGCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178960_1120178973 8 Left 1120178960 14:81324049-81324071 CCGGGGTTCTGGCTCCTCTTGGG 0: 1
1: 0
2: 3
3: 33
4: 266
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178953_1120178973 23 Left 1120178953 14:81324034-81324056 CCCTCCGGACCCTCGCCGGGGTT 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178958_1120178973 13 Left 1120178958 14:81324044-81324066 CCTCGCCGGGGTTCTGGCTCCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178967_1120178973 -6 Left 1120178967 14:81324063-81324085 CCTCTTGGGCTGGGGTGAGGGTG 0: 1
1: 1
2: 5
3: 78
4: 500
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178952_1120178973 24 Left 1120178952 14:81324033-81324055 CCCCTCCGGACCCTCGCCGGGGT 0: 1
1: 0
2: 2
3: 1
4: 78
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434
1120178957_1120178973 14 Left 1120178957 14:81324043-81324065 CCCTCGCCGGGGTTCTGGCTCCT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG 0: 1
1: 0
2: 3
3: 41
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120178973 Original CRISPR AGGGTGGCGAGGGGTCCAGG CGG Intronic
900143117 1:1146771-1146793 AGGGTGGCCACGGGGCCAGTGGG + Intergenic
900297432 1:1959009-1959031 AGGTTGGCGGGGGGACCAGGTGG - Intronic
901625446 1:10622114-10622136 AGGGTGTGGAGGGGTGGAGGTGG - Intronic
901630726 1:10646964-10646986 AGGATGCAGAGGGGTGCAGGAGG + Intronic
901794417 1:11672186-11672208 AGGGTGGTGGGGAGGCCAGGAGG - Intronic
901930870 1:12595590-12595612 CGGGTGAGGAGGGGGCCAGGTGG + Intronic
902279276 1:15362522-15362544 AAGGTGGAGAGGGCTGCAGGTGG + Intronic
902643084 1:17779195-17779217 AGGAGGCAGAGGGGTCCAGGAGG - Intronic
902643090 1:17779212-17779234 GGGAGGGAGAGGGGTCCAGGAGG - Intronic
902776177 1:18676398-18676420 AGGGTGGGGAGGGGGGCAGCGGG + Intronic
902892448 1:19454057-19454079 AGAGTGGCCAGGGCTCCTGGAGG + Intronic
903439197 1:23374752-23374774 GGGGTGGCGAGGGGGCCTAGAGG - Intergenic
903542016 1:24101885-24101907 GGGGTGGCCTGGGGTCCTGGAGG + Intronic
904043006 1:27594832-27594854 AGGGTGCCGTGGGGTGCAGGCGG + Intronic
905773761 1:40654945-40654967 AGGGTGGCCTGGGCACCAGGAGG - Intronic
906057087 1:42925700-42925722 TGTGTGGGGAGGGGTGCAGGAGG + Exonic
906702058 1:47866759-47866781 GGGATGGAGAGGGGTCCAAGGGG - Intronic
907388189 1:54139461-54139483 AGAGGGGCCAGGGGCCCAGGGGG + Exonic
907689057 1:56644977-56644999 AGGGTGCCGAGGGAGGCAGGAGG - Intronic
910487531 1:87731847-87731869 AGGGAGGAGAGGGCTTCAGGAGG + Intergenic
911302400 1:96191567-96191589 ATGGTGGAGGGGGGTCCTGGTGG + Intergenic
914824409 1:151131345-151131367 AGGGTGGTGGGCGGTGCAGGTGG + Intergenic
914967894 1:152277572-152277594 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
915030870 1:152879551-152879573 AGGAGGCAGAGGGGTCCAGGAGG + Intronic
915245399 1:154552661-154552683 ATGGTGGCAAGGGGCCCAAGAGG - Intronic
915270522 1:154750306-154750328 TGGGTGAGGAGGGGTGCAGGAGG - Intronic
917197183 1:172479227-172479249 TGGGAGGAGAGGGGTCCAAGTGG + Intergenic
917416580 1:174816803-174816825 AGGGAGGCGAAGGTTGCAGGAGG - Intronic
920039482 1:203086167-203086189 AGGGTGGGGTGGGGGCCATGCGG - Intergenic
922695498 1:227728998-227729020 GGTGGGGCGAGGGGTCCAGGCGG + Intronic
922764797 1:228151168-228151190 AGGGAGGAGAGGGCTCCACGGGG + Intronic
922795461 1:228337450-228337472 AGGGTGGAGAGGGACTCAGGAGG + Intronic
923648143 1:235845393-235845415 AGGGTGGCTAGAGGAGCAGGGGG + Intronic
924383557 1:243483710-243483732 AGGGAGGAGAGGGGTCAGGGCGG - Intronic
1063944756 10:11165700-11165722 GGGGTCGCCAGGCGTCCAGGTGG + Intronic
1064784454 10:18878386-18878408 AGGATCCCAAGGGGTCCAGGTGG - Intergenic
1066290369 10:34008845-34008867 AGGGAGGCCTTGGGTCCAGGTGG - Intergenic
1067145473 10:43690513-43690535 AGAGCTGCGCGGGGTCCAGGAGG + Intergenic
1067544891 10:47185393-47185415 AAGGTGGGGAGGGGCCCAGGCGG - Intergenic
1069242796 10:66163293-66163315 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
1069607290 10:69747704-69747726 GGGGTGGCCAGGGGTGCAAGGGG + Intergenic
1069682534 10:70295538-70295560 AGGGTAGCAAGGGCTCCAGTTGG + Intergenic
1069782094 10:70963258-70963280 GGGGTGGGGAGGGGACCACGGGG + Intergenic
1069958812 10:72067821-72067843 AGGCTGGGCAGGGGTCCGGGAGG + Intronic
1071283731 10:84125560-84125582 GGGGTGGGGAGGGGGCGAGGAGG - Intergenic
1072696812 10:97609843-97609865 GGGGTGGCGAGGCCTGCAGGAGG + Intronic
1073847468 10:107574169-107574191 AGGGAGGGGAGGGGTGCATGTGG + Intergenic
1073970331 10:109040793-109040815 AGGCCGGCGAGGGTTCCGGGTGG + Intergenic
1074985888 10:118659127-118659149 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1075700637 10:124467380-124467402 AGGGTGGAGAGGGGGCAGGGAGG + Intronic
1075717823 10:124567042-124567064 AGGGAGGGCGGGGGTCCAGGTGG + Intronic
1076379015 10:130012343-130012365 CAAGTGGCGAGGGGTGCAGGTGG + Intergenic
1076562179 10:131374088-131374110 GGGGTGGCGAGGAGGACAGGAGG + Intergenic
1076884501 10:133255566-133255588 GGGGTGGCGGGGTGTCAAGGAGG - Intergenic
1077143439 11:1034828-1034850 AGGGCGGCGGGGGGCGCAGGGGG - Intronic
1077210378 11:1368420-1368442 AGGGTGGAGGAGGCTCCAGGTGG - Intergenic
1077268946 11:1666184-1666206 AGGAGGGCAGGGGGTCCAGGAGG - Intergenic
1077269372 11:1668042-1668064 AGGGAGGTGAGGGGGCAAGGAGG - Intergenic
1077271577 11:1684463-1684485 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271608 11:1684548-1684570 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271621 11:1684575-1684597 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271644 11:1684626-1684648 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271669 11:1684687-1684709 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271692 11:1684738-1684760 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271711 11:1684782-1684804 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271764 11:1684901-1684923 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077271786 11:1684952-1684974 AGGAGGGCAGGGGGTCCAGGAGG + Intergenic
1077288569 11:1778441-1778463 AGGTAGGCGAGGGCTGCAGGAGG - Intergenic
1077333775 11:1994509-1994531 AAGGAGGCCAGGGGACCAGGAGG - Intergenic
1077405299 11:2379888-2379910 AGGGTGGAGGGGGGTCCACCAGG - Intronic
1080258797 11:30323259-30323281 TGGGTGGCGAGGGAGCCCGGCGG + Intronic
1081808561 11:45902817-45902839 AGGGTGGCGGGGGAGCCTGGGGG + Exonic
1083412835 11:62505772-62505794 AGTGTGGCCAGGGGTCCTGCTGG - Intronic
1083694593 11:64434235-64434257 AGGGTGGGGTGGGGGGCAGGGGG - Intergenic
1083860498 11:65417705-65417727 AGGGTGGGGAGGGTTGGAGGAGG + Intergenic
1084147975 11:67275089-67275111 AGGGTGGGGAGCAGGCCAGGGGG + Intronic
1084155503 11:67310656-67310678 AGGCTGGAGAGGGGTCACGGGGG + Intronic
1084312872 11:68326848-68326870 ATGGTGGGGAGGGGTCCCCGGGG + Intronic
1084336357 11:68460294-68460316 AGGGTGGCGAGCTGGCCGGGCGG - Intergenic
1084606009 11:70172250-70172272 AGGGTGACGATCTGTCCAGGAGG + Intronic
1084840491 11:71842597-71842619 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
1084936300 11:72588718-72588740 AGGCTGGCTAGGGCTCCACGAGG - Intronic
1084938986 11:72602302-72602324 AGGGTGGAAAAGGGTCAAGGCGG - Intronic
1085157635 11:74311199-74311221 AGGGTGACAATGGGTCTAGGGGG + Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1088895785 11:114077358-114077380 GAGGTGGCCTGGGGTCCAGGTGG - Intronic
1089189573 11:116644307-116644329 AGGGTTGTGGGGGGTCCTGGGGG - Intergenic
1090405398 11:126473238-126473260 TGGGTGGGGAGGGGGCTAGGTGG - Intronic
1090668542 11:128930702-128930724 AGGGAGGCCAGGGGTTAAGGAGG + Intergenic
1090757246 11:129803403-129803425 AGGGTGGCCAGAGGAGCAGGCGG + Intergenic
1202816756 11_KI270721v1_random:49691-49713 AAGGAGGCCAGGGGACCAGGAGG - Intergenic
1091813560 12:3419530-3419552 TGGGTGGCGAGGGGGCAAAGGGG - Intronic
1092693688 12:11144677-11144699 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
1095696413 12:45149181-45149203 AGAGTGGAGAGTGGACCAGGAGG - Intergenic
1095892702 12:47249677-47249699 AGGGTGGCCAGAGATGCAGGGGG + Intergenic
1095950336 12:47778266-47778288 GGGGTGGGGAGCGGTGCAGGTGG + Intronic
1096717450 12:53499797-53499819 AGGGAGGCGCGGGGCCCAGGCGG - Intronic
1096980972 12:55728252-55728274 TGAGTGGCGAGGGGTCCTGGGGG - Intronic
1097183268 12:57183150-57183172 ATGGTGGCTAGGGGTCCTGCAGG + Intronic
1097265234 12:57740536-57740558 AGGGTGAGGAGGGGTGGAGGTGG - Intronic
1099473108 12:83074959-83074981 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
1101041449 12:100760029-100760051 AGGGAGGAGAGGGGTACATGGGG - Intronic
1102571906 12:113831881-113831903 AGGGAGGCTGGGGGTCCTGGAGG - Intronic
1103156424 12:118689001-118689023 AGGCTGGGGAGGTGGCCAGGTGG + Intergenic
1103173622 12:118843536-118843558 TGGGTGCCGAGGAGTGCAGGAGG + Intergenic
1103433354 12:120905957-120905979 GGGGTGGAGGGGTGTCCAGGAGG - Intergenic
1103581472 12:121918643-121918665 AGGTGGCTGAGGGGTCCAGGCGG + Exonic
1104504575 12:129319187-129319209 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
1104940250 12:132391914-132391936 TGGGTGGCGGAGGGTCCCGGGGG - Intergenic
1105437618 13:20391325-20391347 ATGGAGGCGAGGGGTCTGGGTGG + Intergenic
1105437701 13:20391533-20391555 AGGGAGGCGAGGGGTCGGGGTGG + Intergenic
1105439229 13:20402075-20402097 AGGGGGTCGTGGGGTGCAGGTGG - Intergenic
1106414458 13:29534699-29534721 AGGGTGTGGTGGGGTCCAGTGGG + Intronic
1106517108 13:30465245-30465267 AGGGCGGCGCGGGGGCCTGGGGG - Intronic
1108586079 13:51871037-51871059 ATGGTGGGGAGGGGGCCAGGCGG - Intergenic
1108782907 13:53858413-53858435 AGGGTGGGGAGGGGTGGGGGAGG - Intergenic
1108958214 13:56187562-56187584 GGGCTGGCGCGGGTTCCAGGTGG + Intergenic
1112334308 13:98501361-98501383 GGGGTGGGGCGGGGGCCAGGAGG + Intronic
1112738013 13:102443052-102443074 AGGGTGGCCAGAGGAACAGGGGG + Intergenic
1117510858 14:56449217-56449239 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1118038376 14:61892386-61892408 AGGGTGGCCAGGGGAGCAGTGGG - Intergenic
1118162239 14:63301979-63302001 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
1119484279 14:74977986-74978008 AGGGGAGCAAGGGGTGCAGGGGG - Intergenic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1120856640 14:89218140-89218162 ATGGCGGAGAGGGGCCCAGGGGG - Intronic
1120985660 14:90332116-90332138 AGGGTGGGGCGGGGCCAAGGGGG + Exonic
1121733776 14:96204400-96204422 AGGGTGGCCAGGTGGGCAGGCGG - Intergenic
1121796696 14:96741716-96741738 AGGGGGGCGAGGGGCCGAGGGGG + Intergenic
1122069078 14:99194189-99194211 AGGGAGGACAGGTGTCCAGGTGG - Intronic
1122316374 14:100828057-100828079 TGGCTGGAGAGGCGTCCAGGGGG + Intergenic
1122407284 14:101508132-101508154 AGGCTGGTGAAGGGGCCAGGTGG - Intergenic
1122464022 14:101918405-101918427 AGGGGGGTGAGGGGGCAAGGGGG - Intronic
1123089168 14:105734466-105734488 AGGGTGGAGAGCTGTCCAGCAGG + Intergenic
1123105202 14:105838045-105838067 AGGGTGGAAAGGGGCCCAGGAGG + Intergenic
1124391908 15:29266999-29267021 AGGGAGGTAAGGGGACCAGGAGG + Intronic
1124496849 15:30192361-30192383 AGGGGGGCGTGGGCGCCAGGAGG - Intergenic
1124746727 15:32346286-32346308 AGGGGGGCGTGGGCGCCAGGAGG + Intergenic
1125462330 15:39919604-39919626 AGGATGGAGCGGGATCCAGGCGG - Intronic
1125597849 15:40899065-40899087 AGGGTGGTGTGGGGGCCAGGAGG + Intronic
1126577422 15:50210544-50210566 AGGGTGGCCAGAGGAGCAGGGGG + Intronic
1126688442 15:51267930-51267952 AGGGTGGGGAGGGGCGAAGGCGG - Intronic
1128238644 15:66084703-66084725 AGGGTGGCCAGAGGAGCAGGAGG + Intronic
1129413954 15:75364455-75364477 AGGGTAGCAGGGGGTACAGGGGG + Intronic
1129669311 15:77598381-77598403 AGGGTGGAGATGGGGGCAGGGGG - Intergenic
1129670345 15:77604438-77604460 AGGGTCGCGAGTGGTGCGGGAGG + Intergenic
1129681366 15:77660237-77660259 AGGGTGTCCAGGGGGCCAGGCGG + Intronic
1129694112 15:77730939-77730961 ATGGTGGCCAGAGGTCCTGGGGG - Intronic
1130991659 15:88879297-88879319 GGGGTGGCCAGGGGCCCAGCTGG + Intronic
1131091746 15:89629145-89629167 AGGGTGGTGAGGGCTGCAGGCGG + Intronic
1132092439 15:98957247-98957269 AGGAGGCCGAGGGGTCCAGGGGG - Exonic
1133014458 16:2933075-2933097 GGGGTGGAGAGGAGCCCAGGAGG - Intronic
1136235413 16:28910841-28910863 AGGAGGGCGAGGAGTCCAGCAGG - Intronic
1136248101 16:28986450-28986472 AGTGTGGGGAAGGGTTCAGGCGG + Intronic
1136267865 16:29131500-29131522 AGGACGGGGAGGGGTGCAGGAGG + Intergenic
1139340719 16:66266278-66266300 AGGCTGGTGGGGGGTCCAGCAGG - Intergenic
1139464307 16:67146023-67146045 AGGGTGGCGAGGAGTCAAGAGGG - Intronic
1140078484 16:71723449-71723471 GGGGCGGCGAAGGGTCCGGGTGG + Intronic
1140124688 16:72109376-72109398 AGGGAGGCGAGGGTCACAGGAGG - Intronic
1140296042 16:73710762-73710784 AGGGAGGCCGGGGGTCGAGGGGG - Intergenic
1141602218 16:85133790-85133812 AAGGTGGCCAGGGGTGCAGAGGG + Intergenic
1141612798 16:85192682-85192704 AAGCTGGCGAGGAGGCCAGGAGG - Intergenic
1141671673 16:85495273-85495295 AGGGTGGTGTGGGGGCGAGGAGG + Intergenic
1141877292 16:86834631-86834653 ATGGTGGAGAGGGCTGCAGGGGG - Intergenic
1141945986 16:87310583-87310605 AGGGGAGCGAGAGGCCCAGGGGG + Intronic
1142002406 16:87671259-87671281 GGGGTGACGAAGGGGCCAGGTGG - Intronic
1142071169 16:88091847-88091869 AGGACGGGGAGGGGTGCAGGAGG + Intronic
1142291083 16:89193844-89193866 GGGGTGGCTGGGGGTGCAGGCGG - Exonic
1142429833 16:90019811-90019833 GGGCTGGCGAGGGGCACAGGAGG + Intronic
1142485549 17:245693-245715 AGGGTGGCAGAGGGACCAGGTGG + Intronic
1142493305 17:292661-292683 AGGGTGAAGTTGGGTCCAGGCGG - Intronic
1142559045 17:799116-799138 ACGGTGGCCAGGGCTGCAGGAGG + Intergenic
1142978416 17:3658388-3658410 AGGGGAGCGTGGGGTCCAAGGGG - Intronic
1143490633 17:7283539-7283561 AGGGTGGTGAGGGTGCCTGGAGG - Exonic
1143659345 17:8315179-8315201 AGGGTGTTGCGAGGTCCAGGGGG - Exonic
1144163169 17:12581639-12581661 GGGGTGGGGAGGGGCACAGGTGG - Intergenic
1144573752 17:16416337-16416359 AGGGTGGAGAAGGGGGCAGGGGG - Intronic
1144772880 17:17769646-17769668 AGGATGGGGAGGGGGCCAGATGG + Intronic
1145795777 17:27654612-27654634 AGGGAGGCGAGGGGCCCGTGGGG + Intergenic
1146583322 17:34059397-34059419 AGGGTGGCGAGAGGAGCAGAGGG + Intronic
1146947685 17:36884943-36884965 AGGGTGAGGAGGGGCCCGGGAGG - Intergenic
1147388591 17:40095926-40095948 GGGGTGGCGAGGGGCCCATGGGG + Exonic
1147400521 17:40177916-40177938 ACGGTGGCGGGAGGTCCCGGCGG + Intronic
1147451780 17:40510226-40510248 AGGACAGCGAGAGGTCCAGGAGG - Intergenic
1148764481 17:50029137-50029159 AGAGAGGAGCGGGGTCCAGGTGG - Intergenic
1148953651 17:51335889-51335911 AGGCTGGTGTTGGGTCCAGGAGG + Intergenic
1149607277 17:57933937-57933959 AGGATGGGGAGGGGAGCAGGAGG - Intronic
1151428996 17:74050056-74050078 TCGGTGGCCAGGGGCCCAGGGGG - Intergenic
1151477082 17:74350315-74350337 AAGGAGGGGAGGGGCCCAGGTGG + Intronic
1151719245 17:75846215-75846237 AGGGTGGCGGGGGCTGCAGCTGG + Exonic
1152426506 17:80221090-80221112 AGGCTGGCGGGGGGTGCGGGTGG - Exonic
1152559192 17:81069437-81069459 AGGCTGGGGAGTGGTCCACGGGG + Intronic
1152605621 17:81288254-81288276 ATGGTGTTTAGGGGTCCAGGGGG - Intronic
1152725748 17:81944843-81944865 AGGGTTGGGAGGTTTCCAGGTGG + Intronic
1153216877 18:2828859-2828881 AGAGTGTCGAGGGGTCAAGGAGG + Intergenic
1157769550 18:50333755-50333777 AGGGTGGCTATGGGACCATGGGG + Intergenic
1158844566 18:61428206-61428228 AGGGTGGGGAGGTGTCAGGGTGG + Intronic
1160014056 18:75127468-75127490 AGGGCGGTGAGGGGCCCAGGTGG - Intergenic
1160051971 18:75442198-75442220 TGGGTGGGGATGGGCCCAGGAGG + Intergenic
1160773871 19:846005-846027 AGGGGGTCGTGGGGCCCAGGCGG + Intronic
1160846754 19:1169406-1169428 AGGGTGCCTGGTGGTCCAGGCGG - Intronic
1161198438 19:3000537-3000559 AGGGTGGCGGGGGGACCTGGGGG + Intronic
1161299981 19:3537860-3537882 AGGGTGGGGAGGGGGCCTTGGGG + Intronic
1161348507 19:3779513-3779535 AAGGTGGGGCGGGGCCCAGGCGG - Exonic
1161766421 19:6211330-6211352 CAGGTGGCGAGGAGTCCCGGAGG + Intergenic
1161776328 19:6264237-6264259 GGGGTGGGGAGGGGTGGAGGGGG - Intronic
1162736944 19:12752049-12752071 AGGGGGGCTAGGGGACCTGGAGG + Intronic
1162761636 19:12892010-12892032 GGGGTGGCTATGGCTCCAGGCGG - Intronic
1163154766 19:15433635-15433657 AGGATGGCTAGGGGTGCAGGAGG - Intronic
1163672623 19:18637506-18637528 AGGGTGGTGAGGTGTCTTGGGGG + Intronic
1164621157 19:29696821-29696843 TGGGTGTCCAGGTGTCCAGGTGG + Intergenic
1164621323 19:29697521-29697543 TGGGTGTCCAGGTGTCCAGGTGG - Intergenic
1164621345 19:29697601-29697623 CGGGTGTCCAGGTGTCCAGGTGG - Intergenic
1164621474 19:29698118-29698140 AGGGTGTCTGGGTGTCCAGGTGG - Intergenic
1164621482 19:29698150-29698172 TGGGTGGCATGGTGTCCAGGTGG - Intergenic
1164732575 19:30517413-30517435 AGGGTGGGGAAGGGGCCCGGTGG + Intronic
1165078380 19:33293619-33293641 GGGGTGGGGATGGGTCAAGGGGG - Intergenic
1165287343 19:34852985-34853007 ATGGTGGCCTGGGGGCCAGGCGG + Intergenic
1165412422 19:35670357-35670379 AGGGAGGGGAGGGGAGCAGGGGG - Intronic
1165559809 19:36669177-36669199 TTGGTGGGGAGGGGTCCTGGAGG + Intergenic
1165829579 19:38723853-38723875 GGGGTGGGGAGGGGTCCAGAGGG - Intronic
1165940674 19:39413419-39413441 GGGGAGGCGAGGGGCCCAGGCGG + Intronic
1166383107 19:42365333-42365355 AGGGTGGCAAGGGGAAGAGGTGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166745985 19:45142099-45142121 AGGGCGCCGAGTGGTCCAGCAGG - Exonic
1166783281 19:45353203-45353225 AGCGTGGAGAGGGGTCGGGGAGG - Intronic
1167078262 19:47262144-47262166 AGGGAGGTGGGTGGTCCAGGGGG + Intronic
1167116206 19:47490720-47490742 GGGGTGGCTGGGGCTCCAGGTGG - Intronic
1167428773 19:49442794-49442816 AGGGTAGGGAGAGATCCAGGGGG - Intergenic
1167649928 19:50723618-50723640 AGGCTGGGGAGGTGCCCAGGAGG + Exonic
1167955258 19:53058743-53058765 TGGGGGGAGGGGGGTCCAGGAGG + Intergenic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
925034596 2:676209-676231 AGGGTCCCGGGGAGTCCAGGAGG - Intronic
925208510 2:2027034-2027056 GAGGTGGCGAGGGGTCCAGGTGG - Intronic
925279232 2:2671108-2671130 AGGAAGCAGAGGGGTCCAGGAGG + Intergenic
925317360 2:2936529-2936551 AAGGTGACGACGGGTTCAGGGGG + Intergenic
925317431 2:2936874-2936896 AAGGTGACGATGGGTTCAGGGGG + Intergenic
925402898 2:3588345-3588367 ACGGTTGCCAGGGATCCAGGAGG - Intergenic
926284955 2:11481865-11481887 AGGTCGGCGAGCGGTCCATGAGG - Intergenic
926730239 2:16030790-16030812 AGGGTGGGGTGGGCTCCAGCGGG + Intergenic
927411333 2:22829662-22829684 AGGGTGGTGGGGGTGCCAGGAGG - Intergenic
928949353 2:36800627-36800649 AGGGTGTGGAGGCGTGCAGGAGG - Intronic
929091019 2:38217526-38217548 AGGGAAGGGAGGGTTCCAGGAGG - Intergenic
929598694 2:43191746-43191768 AGGGTGGGGAGTGGTCAGGGAGG - Intergenic
929789739 2:45013931-45013953 CGGGTGGCGCCGGGACCAGGCGG + Intergenic
930048556 2:47195016-47195038 AGGGTAGCGGGGAGGCCAGGTGG + Intergenic
931020918 2:58044714-58044736 AGGTTGGAGAGTGGTCCAGGTGG + Intronic
931453870 2:62391469-62391491 AGGGTTGTGAGGGGTTGAGGGGG - Intergenic
932729006 2:74204590-74204612 AGGCTGGCCAGTGGTCCAGTTGG - Intronic
932777811 2:74539030-74539052 AGGGAGGGAGGGGGTCCAGGAGG - Intronic
932885977 2:75549542-75549564 AGAGTGGGGAGGGGTCCGGCAGG + Intronic
934515119 2:94981507-94981529 AGGATGACGAGGGGTGCAGGTGG + Intergenic
935005778 2:99074882-99074904 CGGGTGGCGAGGGTTGCAGTGGG + Intronic
937151552 2:119689919-119689941 AGGGTGGCTCTGAGTCCAGGTGG - Intergenic
937243327 2:120476447-120476469 AGGGGGGCGACGGGTCCAGTGGG - Intergenic
937295572 2:120807912-120807934 AGGGTGGGGAGGGAGCCAGAGGG + Intronic
937298293 2:120823072-120823094 CGGGTGGCGGGGGGTGCAGGGGG - Intronic
937706355 2:124925099-124925121 AGGATGGCGGGAGGTGCAGGGGG + Intergenic
938049745 2:128157961-128157983 AGGGTGGAAAGGGGACCATGAGG - Intronic
938307292 2:130264725-130264747 GGGATGGCGATGGGTCCAGCAGG + Intergenic
938448037 2:131392119-131392141 TGGGTGGCGATGGGTCCAGCAGG - Intergenic
940443429 2:153747346-153747368 AGGGTAGTGAGGGTTTCAGGGGG - Intergenic
940750821 2:157625599-157625621 GGGGTGCAGAGGGGTGCAGGGGG + Intronic
942135100 2:172917496-172917518 GGGTTGGGGAGGGGTGCAGGGGG + Intronic
945864462 2:215161271-215161293 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
946879390 2:224162025-224162047 AGGCTGGGAAGGGGTGCAGGAGG - Intergenic
947546736 2:231015668-231015690 AGGGTGCCTAGGGGCCCAGAGGG - Intronic
947605454 2:231482994-231483016 AGGGAGGCGAGGGGCTCTGGGGG - Intronic
947942998 2:234075401-234075423 AGGGCGGTGACGGGTGCAGGAGG - Intronic
948542599 2:238701313-238701335 AGGCTGGGGAGGGGTCAGGGAGG - Intergenic
948803526 2:240443357-240443379 AGGGAGGCCTGGGGGCCAGGAGG + Intronic
949005162 2:241641819-241641841 CGGGTGTGGAGAGGTCCAGGAGG + Intronic
949056845 2:241932479-241932501 AGGAAGGGGAAGGGTCCAGGAGG - Intergenic
1169209578 20:3758733-3758755 GGGGTGACGAGGGGACAAGGGGG - Intronic
1169268597 20:4182363-4182385 AGGGTGGAGAGGAGCCCCGGGGG + Exonic
1169277720 20:4244699-4244721 AGGAAGGAGAGGGGGCCAGGAGG - Intronic
1169343932 20:4815446-4815468 AGTGTGGCATGGGGTGCAGGGGG - Intronic
1169517542 20:6333618-6333640 AGGGTGGCTAGAGGAACAGGGGG - Intergenic
1169788260 20:9383902-9383924 ATGGTGACCAGGGGTCCAGGGGG - Intronic
1170764822 20:19280834-19280856 AGAGTGGCTGGGGGTGCAGGCGG + Intronic
1170840721 20:19922812-19922834 AGTATGGGGTGGGGTCCAGGTGG - Intronic
1171165529 20:22967102-22967124 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1173548177 20:43914900-43914922 CGGGCGCCGAGGGGTACAGGCGG - Exonic
1173826239 20:46049486-46049508 TGGGTGGTGAGGGGTATAGGTGG + Intronic
1175199389 20:57267118-57267140 TGAGTGGGGAGAGGTCCAGGCGG - Intergenic
1175610504 20:60347395-60347417 AGGGAAGGGAGGGGTCCAGAGGG + Intergenic
1176081011 20:63273020-63273042 AGGGTGGAGCGGGGTCCGGGTGG - Intronic
1176138445 20:63535133-63535155 AGGGCGGCTGGGGTTCCAGGCGG - Intronic
1177174509 21:17689613-17689635 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1178331394 21:31696623-31696645 ACGGTGGCGGTGGGTGCAGGGGG + Exonic
1178348489 21:31852357-31852379 AGGGTGGCTTGGGGTCATGGAGG - Intergenic
1178423317 21:32459304-32459326 AGGGTGGAGAGGGGTCACGAAGG - Intronic
1179213632 21:39348792-39348814 ACGGTGGCGACGGGCCCGGGAGG - Intronic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1180027811 21:45178311-45178333 AGCCTGGGGAGGGGTGCAGGTGG + Intronic
1181027516 22:20134423-20134445 TGGGTAGGCAGGGGTCCAGGCGG + Intronic
1181162638 22:20967204-20967226 AGGGAGGGCAGGGGTCCAGGAGG - Intronic
1181808680 22:25390680-25390702 ATGGTGGGGAGGGGTCCCCGGGG - Intronic
1182029065 22:27143383-27143405 AGGGTGGAGAGTGGTCCACAGGG - Intergenic
1182074029 22:27482717-27482739 AGGCTGCAGAGGAGTCCAGGAGG + Intergenic
1182351920 22:29704286-29704308 AGGGTGGCGGGGTGGTCAGGAGG - Intergenic
1182351940 22:29704326-29704348 AGGGTGGCGGGGTGGTCAGGAGG - Intergenic
1182351960 22:29704368-29704390 AGGGTGGCGGGGTGGTCAGGAGG - Intergenic
1183048525 22:35241507-35241529 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1183136881 22:35897511-35897533 AAGGTGGCAAGGGGTACGGGAGG + Intronic
1183322520 22:37173755-37173777 GGGTTGGGGAGGGGTCCTGGAGG + Intronic
1183362350 22:37389340-37389362 AGGGTTGCGAGGGGACATGGTGG - Intronic
1183704647 22:39469203-39469225 TGGGTGGGGAGGGGCCCAGAAGG + Intronic
1183735830 22:39644271-39644293 AGGGTGGCTAAGGGTACAGTTGG + Intronic
1183950766 22:41351488-41351510 AGGGAGGCAGGGGGTCCACGAGG - Intronic
1184027048 22:41865628-41865650 AGGGAAGCGAGGTCTCCAGGTGG + Intronic
1184116542 22:42425938-42425960 AGGGTGGGGAAGGGGCCAGAGGG + Intronic
1184427786 22:44423353-44423375 AGGTAGCCGAGGGGTGCAGGAGG - Intergenic
1184655899 22:45941953-45941975 AGGGTGGGGTGGGGTCCCTGAGG + Intronic
1184922505 22:47615317-47615339 AGCCTGAGGAGGGGTCCAGGTGG + Intergenic
1185189563 22:49426256-49426278 CGGGAGGCGGGGGGTGCAGGAGG - Intronic
1185285416 22:49997749-49997771 AGTGGGGTGAGGGGTGCAGGAGG + Intronic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
950441101 3:13010968-13010990 AGTGTGGGGAGGCTTCCAGGAGG - Intronic
950592465 3:13948220-13948242 AGGGTGGCCAGAGGGGCAGGCGG - Intronic
953084598 3:39654385-39654407 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
953578012 3:44128691-44128713 AGGGTGGTGAAGTGTGCAGGAGG + Intergenic
954069108 3:48130008-48130030 ACAGTGGCCAGGAGTCCAGGAGG - Intergenic
954335710 3:49916055-49916077 AGGCAGGCCAGGGGCCCAGGAGG + Intronic
954864680 3:53718557-53718579 GGGGTGGGGAGGTGTGCAGGAGG - Intronic
956420297 3:69080213-69080235 AGGGGGGCGAGGGGACGGGGCGG + Intronic
956510239 3:69985452-69985474 AGGGTGGGGAGGGGTGATGGGGG + Intergenic
958043579 3:88255302-88255324 AGGGTAGTGGGGGGTACAGGAGG - Intergenic
960407737 3:117282739-117282761 AGAGAGGAGAGGGGTCCAAGAGG - Intergenic
961337043 3:126186757-126186779 AGGGTGGGGAGTGGACCAGAGGG + Intronic
961642815 3:128375523-128375545 AGGGTGGCCTGCGGTCCAGAGGG - Intronic
961780043 3:129315961-129315983 AGGAAGGCGAGGGGCCGAGGGGG + Exonic
962381569 3:134902300-134902322 AGGGGAGCCAGGAGTCCAGGAGG + Intronic
962986929 3:140544704-140544726 AGGGTGGGGAGGGGGCAGGGTGG + Intronic
964160575 3:153640649-153640671 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
965216956 3:165875278-165875300 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
965754951 3:172016248-172016270 ATGGTGGGGAGGGGGGCAGGGGG - Intergenic
967963288 3:194941955-194941977 AGGGTGGAGAGGAGGCCTGGAGG - Intergenic
967994503 3:195156401-195156423 AGGGTGGGGAGGGGTCGTGGAGG + Intronic
968263417 3:197343344-197343366 AGGGTGGAGAGTGGATCAGGAGG + Intergenic
968477825 4:820722-820744 AGGCTGGTGAGGGGTGCAGTTGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968511279 4:996981-997003 AGACTGGCCAGGGGTTCAGGCGG - Intronic
969350609 4:6596115-6596137 AGGTGGGCGTGGTGTCCAGGTGG + Intronic
969781571 4:9408591-9408613 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
970346654 4:15159179-15159201 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
971183201 4:24349886-24349908 AGGGTGGCCAGAGGGGCAGGGGG - Intergenic
972319813 4:37963403-37963425 AGGGAGGGGGGAGGTCCAGGTGG + Intronic
973782327 4:54300339-54300361 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
974366393 4:60955149-60955171 GGGGTGTGGAGGGGTGCAGGAGG + Intergenic
974949339 4:68569521-68569543 AGGGTGGCCAGCGGAGCAGGGGG + Intronic
974958372 4:68671715-68671737 AGGGTGGCCAGTGATGCAGGGGG + Intergenic
979704776 4:123708912-123708934 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
981760869 4:148193063-148193085 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
982035377 4:151341080-151341102 AGGGTGGGGAGGGGACCAGTGGG - Intergenic
982134389 4:152259434-152259456 AGGAAGGAGAGGGGTGCAGGTGG - Intergenic
982669111 4:158298962-158298984 CCGGTGGCTAGGGGACCAGGCGG - Intergenic
983427589 4:167606803-167606825 ATGGTGGCAAGGAGGCCAGGGGG + Intergenic
983660666 4:170127919-170127941 AGGCTGGTGTGGGTTCCAGGTGG - Intergenic
984266779 4:177505827-177505849 AGTGTGGCCAGAGGTGCAGGGGG - Intergenic
984749778 4:183261115-183261137 ATGGTGGTGATGGGTCCAGAAGG - Exonic
985616577 5:926612-926634 GGGGACGCGAGGGGCCCAGGAGG - Intergenic
985717597 5:1471444-1471466 AGGGTGGTGAGAGGCACAGGTGG + Intronic
985761516 5:1751537-1751559 GGGAGGGCGAGGGGCCCAGGTGG - Intergenic
985824477 5:2182089-2182111 ATGGTGGCCAGGGGTGAAGGGGG + Intergenic
985875519 5:2591251-2591273 AGGGTGGCGATGGGGCCTGAGGG + Intergenic
986264854 5:6182623-6182645 AGCTTGGCGTGGGGTGCAGGTGG - Intergenic
988902148 5:35745226-35745248 AGGGTGGCCAGAGGAGCAGGGGG + Intronic
990608830 5:57437448-57437470 AGGGTGGTGGGGGGTAAAGGTGG - Intergenic
992204260 5:74414855-74414877 GGGGTGGCGGGGGGTGCTGGTGG - Intergenic
993178484 5:84518722-84518744 AGGGTGGGGGAAGGTCCAGGTGG + Intergenic
995473091 5:112523705-112523727 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
995817734 5:116191200-116191222 AGGGTGGCCAGAGGAGCAGGGGG + Intronic
996124226 5:119706531-119706553 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
996504864 5:124257607-124257629 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
996873292 5:128215564-128215586 AGTGGGGTGAGGGCTCCAGGTGG + Intergenic
997392473 5:133528390-133528412 AGGGTGGGGCAGGGGCCAGGTGG - Intronic
997641362 5:135450938-135450960 AGGTTGGCCAGGTGTCCTGGGGG - Intronic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
1001300522 5:170530487-170530509 AGGGTGTTGAGGGGGCCAGAGGG - Intronic
1001636077 5:173211332-173211354 AGGGTGGCTGGTGGCCCAGGTGG + Intergenic
1001927938 5:175652665-175652687 GGGGTGGAGAGGGATCCAGGAGG - Intergenic
1002575753 5:180172786-180172808 AGGGTGGCAGGGAGTACAGGAGG - Intronic
1003094527 6:3131912-3131934 AAGGTGTGGCGGGGTCCAGGAGG - Intronic
1003637333 6:7844715-7844737 CGGGAGGAGAGGGGGCCAGGAGG + Intronic
1007106271 6:39285227-39285249 AGGTTGGGGATGGGACCAGGAGG + Intergenic
1007292398 6:40797460-40797482 AGGGAGGCTCTGGGTCCAGGAGG - Intergenic
1011789820 6:90885903-90885925 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1015181521 6:130366278-130366300 CGGGTGGCAAGGGGTGCAAGCGG - Intronic
1015501361 6:133937022-133937044 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1016658222 6:146544362-146544384 AGGGAGGCGAGGAGGCCAGGGGG + Intronic
1017809327 6:157973664-157973686 AAGGCTGTGAGGGGTCCAGGAGG - Intergenic
1019124518 6:169829542-169829564 AGGGTGGCAAGGAGACCTGGGGG + Intergenic
1019316499 7:389383-389405 AGGGTCGTGAGGGCTCCTGGAGG - Intergenic
1019335587 7:481077-481099 AGGGCAGGGAGGAGTCCAGGTGG + Intergenic
1019767919 7:2865128-2865150 AGAGTGGGATGGGGTCCAGGTGG + Intergenic
1019940071 7:4282742-4282764 AGGGTGGTGTGGGGGGCAGGTGG + Intergenic
1020001798 7:4760372-4760394 AGGGTGGAGAGTGGCCTAGGAGG - Intronic
1020006294 7:4785254-4785276 ACTGAGGCGAGGGGCCCAGGTGG - Intronic
1020040127 7:4995621-4995643 TGGGTGGCGTGGGGTCAGGGTGG + Intronic
1022171677 7:27837630-27837652 AGGTTGGTGAGGGGTCCCAGAGG + Intronic
1022777777 7:33545290-33545312 AGGGTGGCCAGAGGAACAGGGGG - Intronic
1023159062 7:37279739-37279761 AGGGTGGCCAGTGGAGCAGGGGG + Intronic
1024374544 7:48622126-48622148 AGGCTGGAGAGGGGACAAGGAGG - Intronic
1026010096 7:66629364-66629386 TGGGTGGGTAGGGGTGCAGGTGG - Intronic
1026672613 7:72403172-72403194 GGGGTGGCGCGGGGTCCAGGAGG - Intronic
1026959287 7:74398452-74398474 TGGAGGGCGTGGGGTCCAGGAGG + Intronic
1027659759 7:80975077-80975099 AGGCTGGCGCAGGTTCCAGGTGG - Intergenic
1029381933 7:100220470-100220492 GCCGGGGCGAGGGGTCCAGGAGG + Intronic
1029495115 7:100892401-100892423 AGTTTCGAGAGGGGTCCAGGGGG + Exonic
1031145481 7:117993133-117993155 AGGGTGGTGAGGTTTCCAGATGG - Intergenic
1031972973 7:128077160-128077182 GGGCTGGCGAGGGGCCAAGGTGG - Intronic
1031991777 7:128203239-128203261 CGGGTGGCAGGGGGTCCAAGAGG + Intergenic
1032088095 7:128894083-128894105 AGGGTGGGGAGGGGCCCCTGAGG - Intronic
1032263023 7:130351676-130351698 ATGATGGGGAGGGGTCCAGGAGG + Intronic
1032387499 7:131534540-131534562 AGGGTGGGGTGGGGGTCAGGAGG + Intronic
1032789746 7:135233594-135233616 AGGGTCGCGAGGGGTCAGGGAGG - Intronic
1034337803 7:150334626-150334648 AGTGTGGCGTGGGGCTCAGGAGG - Intronic
1034627334 7:152503620-152503642 AGGGTGGCCAGGTGGCCAGGTGG + Intergenic
1035519804 8:266834-266856 AGTGGGGAGAGGGGACCAGGAGG + Intergenic
1036208861 8:6825887-6825909 GGAGTGGCCAGAGGTCCAGGTGG + Intronic
1037490880 8:19396028-19396050 AGGTGGGCGGGGGTTCCAGGAGG - Exonic
1039052206 8:33505259-33505281 AGGGTGGGGAGGGGGAAAGGAGG + Intronic
1039413582 8:37375460-37375482 AGGGAGGAGAGGGGGCCTGGGGG - Intergenic
1039603162 8:38858787-38858809 AGGGAGGCGTGGGTACCAGGAGG + Intergenic
1039900863 8:41751712-41751734 AGGCTGGTGCGGGGGCCAGGTGG - Intronic
1041196825 8:55409046-55409068 GGAGTGGACAGGGGTCCAGGAGG + Intronic
1041748673 8:61236040-61236062 AGGGTGGAAAGCAGTCCAGGAGG - Intronic
1042088526 8:65133522-65133544 AGGGTGGCCAGAGGACCAGAGGG + Intergenic
1044456026 8:92393877-92393899 AGGTTGGCGCAGGTTCCAGGTGG - Intergenic
1045336023 8:101205315-101205337 CGGGTCGCGAGGGGTCGCGGGGG - Intronic
1047130828 8:122017879-122017901 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1048342806 8:133553924-133553946 AGGGTGCTAAGGGGGCCAGGAGG + Intronic
1048345393 8:133571542-133571564 GGGGTGGGGAGGGGACTAGGAGG - Intronic
1049382750 8:142325570-142325592 AGGGTGGCGTGGGGTCCTGGAGG + Intronic
1049575480 8:143387881-143387903 AGAGGGGCCAGGGCTCCAGGGGG - Intergenic
1049649955 8:143761236-143761258 AGGCTGGCGCGGGGCCCCGGGGG - Intergenic
1049979641 9:892410-892432 AGGGTGGGCAGGTGTGCAGGTGG - Intronic
1052343517 9:27385470-27385492 AGGGTGGTGAGGGGTTGAGAGGG + Intronic
1052359766 9:27541260-27541282 AGGGTGGAGAGGTGTGCTGGGGG + Intergenic
1052996398 9:34553670-34553692 GGGGTGGCGATGCCTCCAGGAGG - Intronic
1055440571 9:76332325-76332347 AGGGAGGAGAGGGCTGCAGGAGG - Intronic
1056322807 9:85452462-85452484 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1057211052 9:93201329-93201351 GGAGTGGGGATGGGTCCAGGTGG + Intronic
1057647503 9:96890400-96890422 GTGGTGACAAGGGGTCCAGGGGG + Intergenic
1058085113 9:100740154-100740176 AGGGTGGCTAGAGGAGCAGGGGG - Intergenic
1058623271 9:106905978-106906000 AGGGTGGCCAGAGGAGCAGGGGG - Intronic
1059424885 9:114214798-114214820 TTTCTGGCGAGGGGTCCAGGTGG + Intronic
1059455521 9:114398071-114398093 AGGGAGGGGAGGGGTCCCGGGGG - Intergenic
1060089574 9:120731135-120731157 AGGGTGGCGAGTGGACCACAGGG + Intergenic
1060345569 9:122812925-122812947 AGGGTGGCCAGGCTGCCAGGTGG + Intronic
1060770614 9:126329179-126329201 AGGGTCACCTGGGGTCCAGGAGG - Intronic
1061254531 9:129446741-129446763 GGGGTGGCGGGGGGAGCAGGAGG - Intergenic
1061328025 9:129875725-129875747 AGTGTGGTGTGGGGTCCTGGTGG - Intronic
1061330726 9:129890590-129890612 AGGAAGGCGCGGGTTCCAGGCGG + Intronic
1061710960 9:132487332-132487354 TGGGGGGCGAGGGGTCATGGAGG - Intronic
1061991071 9:134159079-134159101 AGGCAGGCGAGGGCTCCAGCAGG - Exonic
1061993779 9:134173919-134173941 AGGCAGGCGAGGGGCGCAGGAGG - Intergenic
1062022694 9:134326770-134326792 AGGTCGGCGAGGGGTCCGAGCGG - Intronic
1062155938 9:135048559-135048581 ACCGTGGTGAGGAGTCCAGGTGG + Intergenic
1062380507 9:136284593-136284615 AGGGAGCCGCGGGGACCAGGAGG + Intronic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1062579021 9:137221528-137221550 AGGCTGGCGAGGGGGCGCGGGGG + Exonic
1062613089 9:137383708-137383730 AGGTTGCCGAGGGCGCCAGGCGG - Intronic
1186099829 X:6144279-6144301 AGAATGGAGAGGGGTCCAGAAGG + Intronic
1187430726 X:19221963-19221985 AGGGTGGCCAGAGGAGCAGGTGG - Intergenic
1187748313 X:22433248-22433270 AGGGTGGCCAGAGGAACAGGGGG + Intergenic
1189218094 X:39344631-39344653 AGGGTGGCCAGAGGAGCAGGGGG + Intergenic
1191151884 X:57228226-57228248 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1192168708 X:68841519-68841541 AGGGAGGTGAGGTGCCCAGGTGG + Exonic
1192174848 X:68879252-68879274 AGGGTGGCAGGGCGTGCAGGAGG - Intergenic
1193417680 X:81243390-81243412 AGGGTAGCGAGGGGGTCGGGAGG + Intronic
1196590562 X:117481948-117481970 AGGGTGGCCAGAGGAGCAGGGGG - Intergenic
1196871352 X:120116091-120116113 AGTGTGGGGTGGGGTGCAGGTGG + Intergenic
1198321505 X:135521919-135521941 AGGAAGGGGAGGGGACCAGGAGG - Intronic
1200094047 X:153649055-153649077 AGGGTGGCTAGGGCCCCACGTGG + Intronic
1200136031 X:153875283-153875305 AGGGTGACCAAGGGCCCAGGAGG + Intronic
1200775597 Y:7167485-7167507 TGTGTGGCGAGGGGAGCAGGGGG + Intergenic
1201582120 Y:15520423-15520445 AGGGTGGGAAGGGGTGAAGGAGG - Intergenic