ID: 1120183364

View in Genome Browser
Species Human (GRCh38)
Location 14:81367793-81367815
Sequence CTCTGGGCCTGGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 1, 2: 10, 3: 74, 4: 610}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120183355_1120183364 8 Left 1120183355 14:81367762-81367784 CCCAGGCTCATGGAGATATACTA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG 0: 1
1: 1
2: 10
3: 74
4: 610
1120183354_1120183364 16 Left 1120183354 14:81367754-81367776 CCTCATTTCCCAGGCTCATGGAG 0: 1
1: 0
2: 2
3: 23
4: 274
Right 1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG 0: 1
1: 1
2: 10
3: 74
4: 610
1120183353_1120183364 17 Left 1120183353 14:81367753-81367775 CCCTCATTTCCCAGGCTCATGGA 0: 1
1: 0
2: 6
3: 86
4: 1176
Right 1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG 0: 1
1: 1
2: 10
3: 74
4: 610
1120183356_1120183364 7 Left 1120183356 14:81367763-81367785 CCAGGCTCATGGAGATATACTAC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG 0: 1
1: 1
2: 10
3: 74
4: 610
1120183351_1120183364 18 Left 1120183351 14:81367752-81367774 CCCCTCATTTCCCAGGCTCATGG 0: 1
1: 0
2: 2
3: 20
4: 279
Right 1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG 0: 1
1: 1
2: 10
3: 74
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120183364 Original CRISPR CTCTGGGCCTGGAGGGCAGA TGG Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900314997 1:2052004-2052026 CTTTTGGCCTGGAGGTCAGCAGG + Intronic
900346447 1:2212720-2212742 CTCGTTGCCTGGAGGACAGAGGG + Intronic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
900744978 1:4354962-4354984 CTCTGTGCCTGGTGAGCACAGGG + Intergenic
900827125 1:4935727-4935749 ATCTGGGCATGGAGCTCAGACGG + Intergenic
901039863 1:6357402-6357424 CACGGGGCCTGCAGGGCAGGCGG + Intronic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901490998 1:9596131-9596153 CTCAGGGCCTGGAGAGGACAGGG - Intronic
901883442 1:12207174-12207196 CTCTTGGCCTGCAGGTCAGAGGG - Exonic
902334573 1:15747594-15747616 CTCTGGGACTGGGGTGCCGAGGG - Exonic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902412119 1:16217692-16217714 CTCTGGGCCAGGTGGGCATGGGG + Intergenic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902925891 1:19695445-19695467 ATCTGAGCCTGGGGTGCAGAGGG - Intronic
903009236 1:20318631-20318653 CTCTTGGCCGAGCGGGCAGATGG - Exonic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903035720 1:20491406-20491428 CTCTGGGCTTGGAGCTCTGAGGG + Intergenic
903259943 1:22126213-22126235 CTCCTGGCCTGGAGGCAAGATGG - Intronic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904420175 1:30386140-30386162 CTCTTGGCCTGCAAGGCAGGTGG + Intergenic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905254470 1:36671310-36671332 CTCTGGGCCAGTGGGGCAGCAGG - Intergenic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
905408819 1:37754309-37754331 CTCTGGGCACGGTGAGCAGAGGG + Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906461935 1:46041209-46041231 CACTGGGCCTGGTGTGTAGAGGG - Exonic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908868163 1:68576070-68576092 CCCTTGGCCTTGAGAGCAGAGGG - Intergenic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913330952 1:117667014-117667036 CTTTGGCCCTTGAGGGCAGTGGG + Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
914920555 1:151844503-151844525 CTCTGAGCCTGGGGAGGAGAAGG - Intergenic
915213395 1:154325740-154325762 CGCGGGGCCAGGAGGGCAGAGGG + Intronic
915230417 1:154441732-154441754 GTCTGGGCCTTGAGAGCTGAAGG - Intronic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915571931 1:156749599-156749621 CTTTGGGCCTCCAGGACAGAAGG - Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919077409 1:192830384-192830406 CGCTGGGCCTGTTGGGCAGTGGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919880557 1:201897985-201898007 TCCTGGCCCTGGAGGGCAGTGGG + Exonic
919881361 1:201903335-201903357 CTTGGGGCCTGCAGGGCAGGAGG - Intronic
921277780 1:213536642-213536664 CCTTGGGCCTGGATGGCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922586287 1:226737084-226737106 CTCCGGCCCTGGCGGGGAGAGGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924342410 1:243050047-243050069 CCCTGGGCTTTCAGGGCAGATGG - Intergenic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
924934201 1:248754814-248754836 CACCGGGCCTGGAGGGGTGAGGG - Intronic
1062894044 10:1089379-1089401 CTCTGGGCCTGGGGGCCTCAGGG + Intronic
1063364001 10:5478870-5478892 CTCTGGTCCTGCAGGCCAGGCGG - Intergenic
1064012257 10:11743833-11743855 TTCTGGGCATGGCGGCCAGATGG + Intronic
1064265204 10:13820385-13820407 CTCTGGGCTGGGAAGGCAGGCGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067145416 10:43690221-43690243 CTCTGGGCTGGGCCGGCAGAGGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067741402 10:48898361-48898383 CCCTGGGCCTCCAGGGCAGCTGG + Intronic
1069043362 10:63717826-63717848 CTCTGGGCATTGGGGGCAGGGGG - Intergenic
1069256542 10:66338282-66338304 GCCTGGGCCTGGAGGTCGGAAGG + Intronic
1069740661 10:70685158-70685180 CCCTGGGGCTGGAAGGCACATGG - Intronic
1069942259 10:71964082-71964104 CCCGGGGACTGGAGGGCCGAGGG + Intergenic
1069951966 10:72025223-72025245 CTCCCAGACTGGAGGGCAGAAGG + Intergenic
1070503337 10:77091593-77091615 CTATGAGCCTGGGGGGCACAGGG - Intronic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071525043 10:86353693-86353715 GCCTGGGCCTGGAGAGCTGAGGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1072391579 10:94992935-94992957 ATCAGGGGCTGGAGGCCAGAAGG + Intergenic
1072806127 10:98424977-98424999 ATCAGGGCCTGGACGGCAGTGGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073288508 10:102402185-102402207 ATCTGGACCTGGAGGGCCGGAGG + Intronic
1073438281 10:103535701-103535723 CTCTGGCCCAAGGGGGCAGAAGG + Intronic
1074421027 10:113309128-113309150 CCCTGGGCCTGCAGGGATGAAGG + Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075599136 10:123754412-123754434 CACTGTGCCTGGAGGCCAGCTGG + Intronic
1075648559 10:124112410-124112432 GACTGGGCCTGCAGAGCAGAGGG + Intergenic
1075650011 10:124121595-124121617 CTCTGGGCCTGGAGAGCTCCTGG - Intergenic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1075746992 10:124734911-124734933 CCCTTGGCTTGGAGGACAGAGGG - Intronic
1076159580 10:128233235-128233257 CTCTGGCCCTGGAGGTTAAATGG + Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076193881 10:128501161-128501183 TTCTGGGCCTTGTGGGCACAGGG - Intergenic
1076302258 10:129437243-129437265 CTCTGGGGCTGGGTGGTAGAAGG - Intergenic
1076317199 10:129550952-129550974 GTTTCGGCCTGGAGGGCAGGTGG + Intronic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076581892 10:131517375-131517397 CTCTGGGGCTGGATGGATGAGGG + Intergenic
1076643783 10:131937344-131937366 AGCTGAGCCTGGAGGGCAGTGGG - Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1076990511 11:271102-271124 CTCTTGCCCTGCAGGGCAGGGGG - Intergenic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077404107 11:2375174-2375196 CTTGGGACCTGGAGGCCAGAGGG - Intergenic
1077497151 11:2891884-2891906 CTCTGACCCTGGAGGTCAGTGGG - Intronic
1077508434 11:2942885-2942907 TTCTGGTCCTGGAGGCCAGGGGG - Intergenic
1077645575 11:3920694-3920716 ATCTTGGCCAGGAGAGCAGAAGG - Intronic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1079101315 11:17544010-17544032 CCCTGCCCCTGGAAGGCAGAGGG + Intronic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080453133 11:32395301-32395323 CTCTGGGCCTTGTGGGCACTAGG - Intronic
1080711069 11:34748551-34748573 CTAGTGGCCTGGAGGGCAGGAGG + Intergenic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1081610049 11:44556522-44556544 CTCTTGGGCTGGAGCGCAGTGGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1082813573 11:57493716-57493738 CTCTGGGCCTGTCGGGTAGCTGG - Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083325711 11:61871998-61872020 CCCTGGGCCGGGAGGCCATAGGG + Intergenic
1083771816 11:64871764-64871786 CTTTGCACCTGGAGGGGAGAGGG + Intronic
1083889923 11:65590604-65590626 CCCCGGGCCAGGAGAGCAGAGGG + Intronic
1084091678 11:66882916-66882938 TTCTGGGCAGGGGGGGCAGAAGG + Intronic
1084112285 11:67022242-67022264 CTCTGGGCCTTTAGAGCTGAGGG - Intronic
1084383123 11:68826068-68826090 CCCTGGCCCTGGAGAGTAGAGGG + Intronic
1084419902 11:69055118-69055140 CTCTGGGCCCTGAGGGCTGCTGG + Intronic
1084731935 11:71079374-71079396 CTCTCCGCGTGGAGGGCATATGG + Intronic
1084758466 11:71253116-71253138 TTCTTGGCTTGGAGGGCAGCTGG - Intergenic
1084889529 11:72229909-72229931 TTCAGGGCCTGGAGGGAACAAGG - Exonic
1084936723 11:72590668-72590690 CCCTGGGCCCGGCAGGCAGAGGG - Intronic
1085769107 11:79309369-79309391 TCCTGGCCCTGGAGGTCAGATGG + Intronic
1087056542 11:93942039-93942061 CTCCAGCCCTGGAGGTCAGAGGG + Intergenic
1088917910 11:114241005-114241027 CTCTGGGCCAGGAGGAAACATGG - Intronic
1089278417 11:117355501-117355523 CACTGGCCCTGGAGGGGACAAGG + Intronic
1089338751 11:117743586-117743608 AACTGGGCCTGGAGCCCAGAGGG - Intronic
1089460806 11:118652291-118652313 CTCTGGGCCAGGAAGGTAGAGGG + Intronic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1090444901 11:126755807-126755829 CTCTCTGCCTGAATGGCAGATGG - Intronic
1090747665 11:129720307-129720329 GGCTGGGCCTGCAGGGCTGAGGG - Intergenic
1090768250 11:129895592-129895614 CTCTGGGCCTGCGCGGCGGAAGG + Intergenic
1090799059 11:130159629-130159651 CTCTGGGCCTGAAGGTGAGGGGG - Exonic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1091467954 12:702032-702054 GCCTGGGCCTGGAGGGAGGAAGG + Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091590830 12:1842195-1842217 ATCAGGGCGTGGAGTGCAGAAGG + Intronic
1091721507 12:2817333-2817355 CCCTGGGCCTGGAGGGGGGAAGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092119196 12:6032002-6032024 TTCTGGGCCAGCAGTGCAGAGGG - Intronic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096389359 12:51217359-51217381 CTCTGGACCTGGAGCGGAGGGGG - Intronic
1096513557 12:52144748-52144770 GCCTGGGCCTGGATGGCAGCTGG + Intergenic
1096677250 12:53232340-53232362 CCCTGGGGCTGGGGGGCGGAGGG + Intronic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1097246624 12:57610968-57610990 CCCGGGGCCTGGAGGAAAGAAGG + Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099729633 12:86484300-86484322 CTCTTGGCCTGGTGGCCAGCTGG - Intronic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100258143 12:92904973-92904995 CTCTATGCCTGAAGGTCAGAGGG + Intronic
1101111461 12:101490773-101490795 CTCTTGGCCTGGACTGAAGATGG - Intergenic
1101316775 12:103635948-103635970 ATCTCAGCCTGGAGGGAAGAAGG + Intronic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102101247 12:110280903-110280925 CTCTGGGGCCGGTGGGCGGATGG - Intronic
1102655737 12:114480943-114480965 CTCAGGTCCTGGAGTCCAGAAGG - Intergenic
1103243965 12:119439348-119439370 CCCTAGACCTGGAGGGGAGAAGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103970147 12:124665571-124665593 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1104185195 12:126423798-126423820 CTCTGGCCCTGGAGAGCAGTGGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104662267 12:130619941-130619963 CTCTGTGCCAGGAAGACAGAGGG + Intronic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104755131 12:131264513-131264535 CTCAGAGCCTGAAGGGTAGAGGG - Intergenic
1105280328 13:18959409-18959431 CCCTGGGCCTTGAGGCCTGAGGG + Intergenic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106122330 13:26870875-26870897 CACTTGGCCAGGAGGCCAGAGGG - Intergenic
1106285818 13:28317338-28317360 ATCTGGGCCTGATGGGCTGAGGG + Intronic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114674299 14:24430410-24430432 AGCTCGGCCTGGAGGCCAGAAGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119428879 14:74552839-74552861 AGCTGGCCCTGGAGGGTAGATGG - Intronic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121323072 14:93004043-93004065 CTCTGGGCCTGGGAGGCATCTGG - Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121547249 14:94771249-94771271 CTCTGGGCCTGCCAGGCGGAAGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1122316776 14:100830111-100830133 CTCTGGGCCAGAGGGGAAGAAGG - Intergenic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1122645622 14:103191521-103191543 CTCTTGGCCTCGAGGGAAGGCGG + Intergenic
1122691607 14:103534389-103534411 AGCTGGGACTGCAGGGCAGAGGG - Intronic
1122891504 14:104734217-104734239 CTCTGCTCCTGCAGGGCAGGTGG - Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1122961237 14:105094413-105094435 ACCTGGGCCTGGGGGACAGAGGG - Intergenic
1123024972 14:105420140-105420162 CGCGGGGCCTGCGGGGCAGAGGG - Intronic
1124340927 15:28888736-28888758 CTCTGGGCCTGGGTGGCGGGCGG + Intronic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124657916 15:31523730-31523752 CTCTGGGGCTTGAGGGCTGCAGG - Intronic
1124956902 15:34366126-34366148 CTTTGGGCCTAGGAGGCAGAGGG + Intronic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1125727719 15:41876640-41876662 CTCTGACCCTGGAGGGCGGGGGG + Exonic
1126288794 15:47047529-47047551 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1127974231 15:63985390-63985412 CTCTGGGCCTCGAGGACAGCGGG + Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128639152 15:69323178-69323200 CTCTTGGCCTAGTGGACAGAGGG - Intronic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1128927186 15:71668438-71668460 CTCTGAGCCTGGAAGACAGCAGG + Intronic
1129002382 15:72345543-72345565 CTCTGGGCCTGGAGGAAAAGGGG + Exonic
1129712714 15:77828773-77828795 CTCTGGGCCTGGGGTGTAGGGGG - Intergenic
1132140068 15:99385037-99385059 CCTTGGGCCTGAAGGGCAAAGGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132597722 16:760889-760911 CTCGGGACCTGGAGGGCTGGGGG + Intronic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133218896 16:4309889-4309911 CTCTGGGCCCTGCGGGCAGGTGG + Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1134630213 16:15750760-15750782 CCCAGGGCCTGGAGCACAGAAGG - Intronic
1134685654 16:16156444-16156466 CTCTCGGCCAGGGGGGCACATGG - Intronic
1135547710 16:23377060-23377082 CACAGGGCCAGGAGAGCAGAGGG + Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1136922994 16:34346704-34346726 TTCTGGGCCTAGAGGCCAGCTGG + Intergenic
1136981579 16:35065102-35065124 TTCTGGGCCTAGAGGCCAGCTGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137694163 16:50450018-50450040 AGCTGGGCCTGGAAGGCAGGTGG + Intergenic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1139126519 16:64084901-64084923 CACTGTGCCTGGGGGCCAGATGG - Intergenic
1139431601 16:66913732-66913754 CCCTGGGCCTGGAGTCCAGGTGG + Intronic
1140123972 16:72105316-72105338 ATTTTGGCCTGGAGGTCAGAAGG - Exonic
1140210971 16:72969952-72969974 CTCTGGGCCTTCTGGGCAGTGGG - Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1142403209 16:89871876-89871898 CGTGGGGCCTGGAGGTCAGAAGG + Intergenic
1142557508 17:789912-789934 CCCTCTGCCTGGAGGGGAGAAGG - Intronic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142959306 17:3542743-3542765 CTCTGGGCTGGGAGGGCCAAGGG - Intronic
1143289273 17:5816737-5816759 CTCAGGGCCTTGGAGGCAGAAGG + Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143868401 17:9940592-9940614 TTCTGGGGCTGGAAGGGAGAGGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144753827 17:17667829-17667851 CACAGGCCCTGGAGGGCAGCAGG + Intergenic
1145016647 17:19403132-19403154 CACTGGGCCTGGGGGACAGGAGG + Intergenic
1145746844 17:27326215-27326237 CTCCAGACCTGGAGGGCAGGCGG + Intergenic
1145761973 17:27430322-27430344 GTCTGGGGCTGCAGGGCAGCTGG - Intergenic
1145776275 17:27531323-27531345 CCCTGGGCCTGTGAGGCAGAAGG - Intronic
1146000359 17:29126921-29126943 CCCTGTGCTTGGATGGCAGATGG - Intronic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1147955793 17:44133664-44133686 CTCTAGGCCAGGAAGGCAGGAGG - Intergenic
1148000838 17:44386042-44386064 CTGTGCCCCTGGAGGGCCGAGGG - Exonic
1148804399 17:50257111-50257133 CTCTGAGCCTGGGGGACAGCAGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1148892813 17:50820169-50820191 CTTTGTGCCTGCAGGGCACAGGG - Intergenic
1150009145 17:61488400-61488422 CTCTGGGGCAGGAGGGCTCAGGG + Intergenic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151030093 17:70727499-70727521 TTCTGTGCCAGGAGGGCACACGG + Intergenic
1151345430 17:73498486-73498508 CTCTGTGCCGGGCAGGCAGAAGG + Intronic
1151475569 17:74342837-74342859 CTCTGGGGCTGGAGGGCCCTGGG - Intronic
1151492950 17:74443483-74443505 CTCTGGCCCCGGAGGGCGGATGG + Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1152019321 17:77772167-77772189 CTCAGGGCCTCAAGGGCAAAGGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152276744 17:79362479-79362501 CGCTGGGCCTGGATGGCACTAGG + Intronic
1152330749 17:79671196-79671218 CTCTGAGCCTGGATGGAGGAGGG - Intergenic
1152563085 17:81088345-81088367 CACAGAGCCTCGAGGGCAGAAGG - Intronic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155067463 18:22280081-22280103 CTCTGGCCCTGAAGGGGACAGGG + Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156356776 18:36348901-36348923 CTCTGCACCTGGATGGCAGGTGG - Intronic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1157397793 18:47357184-47357206 CTCTCTGCCTGGTGTGCAGATGG + Intergenic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158706356 18:59795842-59795864 CTGTGGGCCTGGAGGGTAACTGG + Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160904983 19:1447744-1447766 GCCAGGGCCTGGAGGGCTGAGGG - Intronic
1160984742 19:1833417-1833439 CTCTGCGCCTGCTGGGCACATGG - Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161383117 19:3976984-3977006 CTCTGGGCCTGGAGCTCTGAAGG - Intronic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1161948720 19:7455187-7455209 CTCGGCGCCTGGCAGGCAGAAGG - Intronic
1161956723 19:7500214-7500236 CTCTAGGCCTGGAGGCCAGCAGG - Intronic
1161980692 19:7628734-7628756 ATCTGGGCCTGGGGTGGAGATGG - Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162785636 19:13033037-13033059 CACAGGGCCTGGTTGGCAGACGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163154597 19:15432878-15432900 GTCTGGGCCCTGAGGGCGGACGG + Intronic
1163221314 19:15923293-15923315 CTCTCGCCCTGGAAGGAAGAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163427103 19:17245762-17245784 CTCCGGGCCTGCAGGGCCGCTGG + Exonic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163514696 19:17755820-17755842 CCCTGGTCCTGCAGGGCTGAAGG - Intronic
1163567413 19:18059787-18059809 ATCAGGGCCTGGAGGCCTGAGGG - Intronic
1163584425 19:18156161-18156183 CACGGGGCCTGGCGGGCAGTGGG - Exonic
1163756803 19:19111232-19111254 CTCTGAGCCTGGTGGGGACAGGG - Exonic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165763349 19:38335656-38335678 CGCGGGGCCTGGTCGGCAGAGGG - Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166202751 19:41249070-41249092 CGCTAGGCCTGAAGGGTAGAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166299487 19:41905972-41905994 CTCGGGGCCTGGTCTGCAGAAGG - Exonic
1166864192 19:45826156-45826178 CTCTGGGCCCTGCGAGCAGAGGG - Intronic
1166993147 19:46705119-46705141 TTCAGGGCCTGGGGGGCAGATGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167135592 19:47613401-47613423 GCCTGGGCTTGGAAGGCAGAGGG + Intronic
1167442418 19:49516058-49516080 CTCTGGGCCTTGAGCAAAGAGGG + Intronic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
1168340057 19:55617567-55617589 CTCAGGGCCTGGCAGGCAGGAGG - Exonic
1168417101 19:56176069-56176091 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417130 19:56176169-56176191 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417158 19:56176269-56176291 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417174 19:56176319-56176341 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417190 19:56176369-56176391 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417206 19:56176419-56176441 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417220 19:56176469-56176491 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417236 19:56176519-56176541 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417250 19:56176569-56176591 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417265 19:56176619-56176641 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417279 19:56176669-56176691 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168703174 19:58453509-58453531 GCCTGGACCAGGAGGGCAGAGGG + Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
925293659 2:2764194-2764216 CTCTGGCCCTGCAAGGCGGAGGG + Intergenic
925343092 2:3150162-3150184 GTCGGGGCCTGGAGGGGAGTAGG + Intergenic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
926531310 2:14049672-14049694 ACATGGGCCTTGAGGGCAGAGGG - Intergenic
926549968 2:14289206-14289228 CTATAGTCTTGGAGGGCAGAAGG - Intergenic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929636523 2:43527934-43527956 CTCTGTGCCTGGACTGCAAAAGG + Exonic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930002120 2:46868638-46868660 CTCTGGGCCTCCAAGACAGAAGG - Intergenic
930100821 2:47601491-47601513 CTCTAGGCCTTGGGGGCAGCAGG - Intergenic
930240742 2:48933505-48933527 CTCTGGGCCTTGGGGGGAAAAGG + Intergenic
931567277 2:63627880-63627902 CTCTCCACCAGGAGGGCAGAGGG - Intronic
931976956 2:67653692-67653714 CACTGGGCCTGGAAGGCTTAGGG + Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932217566 2:69976701-69976723 CTCTGTGCCTGGAGGGGGAAAGG - Intergenic
932443191 2:71751272-71751294 ATCTGGGCCTGGAGTGGTGATGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
932893652 2:75617805-75617827 CTCAGGTCCTTGAGGGCTGAGGG - Intergenic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934926892 2:98388448-98388470 CTTCGGCCCTGGAGGGGAGAGGG + Intronic
935697108 2:105779603-105779625 CACTTGGCCTTGTGGGCAGATGG + Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
935958817 2:108403779-108403801 ATCAGGGGCTGGAGGCCAGATGG - Intergenic
936716232 2:115190600-115190622 ATCAGGGGCTGGAGGCCAGATGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938036856 2:128041837-128041859 ATCAGGGACTGGAGGCCAGATGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
939675687 2:145069534-145069556 TCCTGCACCTGGAGGGCAGAGGG + Intergenic
940004453 2:148998381-148998403 CTCTTGGCCTGGGATGCAGAAGG + Exonic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
942241195 2:173964945-173964967 CCCGGGGCCTGGCGGGGAGACGG + Intronic
943148289 2:184074549-184074571 CTCTGTGCCAGGAGGTCTGAAGG + Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945483318 2:210366915-210366937 ATCAGGGGCTGGAGGCCAGATGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948876356 2:240831847-240831869 GTCAGGGCCTGGAGGGGAGCTGG + Intergenic
948990510 2:241551673-241551695 CCCTGTGCCTGGGAGGCAGATGG - Intergenic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
949043771 2:241860960-241860982 GTCTGAGCCTGGAGAGCACAGGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1168902129 20:1373926-1373948 TTCTGTTCCTGCAGGGCAGAGGG - Intronic
1169150666 20:3286934-3286956 CTCTGAGCCTGGAGTGGTGATGG + Intronic
1169218137 20:3805019-3805041 CTATGGGCCTGCCGGGCTGAGGG + Exonic
1169674938 20:8142915-8142937 CTCAGGGGCAGGAGGGCAGCTGG - Intronic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1170880869 20:20295831-20295853 CTCTAGGCCTGGATGCCACATGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171540877 20:25954607-25954629 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171800191 20:29605703-29605725 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1171843904 20:30251000-30251022 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1174216306 20:48919351-48919373 CTCCCAGGCTGGAGGGCAGAGGG + Intergenic
1174413197 20:50349343-50349365 GGCTGGGCCTGAATGGCAGAGGG - Intergenic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1174842351 20:53912146-53912168 CCCTGGGCCTGCAGGCCAGTTGG + Intergenic
1175119284 20:56705935-56705957 CTCTGGGCCAGTATTGCAGATGG - Intergenic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178351308 21:31874250-31874272 CTGCCGGCCTGAAGGGCAGAGGG - Intronic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1178705064 21:34866180-34866202 CTCTGAGCCCCCAGGGCAGACGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180967936 22:19800261-19800283 ATCTGGGCCAGGACGGCAGGAGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1182095685 22:27623819-27623841 GTTTGGGCTTGGAGGGCTGAGGG - Intergenic
1182273184 22:29168733-29168755 CCCAGGGCCTTGTGGGCAGAGGG - Intergenic
1182445443 22:30387080-30387102 CTCTGGTCCTGGAGGGCGTCAGG - Exonic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183197608 22:36364266-36364288 CTCTAGTCCTGCAGGGCTGAGGG + Intronic
1183540481 22:38426780-38426802 GGCCGGGCCTGGAGGTCAGATGG + Exonic
1183942296 22:41302394-41302416 GTCTGGGCCTGCTGGGCAGGGGG + Intronic
1184054510 22:42035373-42035395 CTCTGGGCCCTGAGAGCACAGGG + Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1185134288 22:49060316-49060338 CTCTGGGGCAGGAGGGCTGGAGG - Intergenic
1185172879 22:49303895-49303917 GCCTGGGCCTGGCGGGCAGGAGG - Intergenic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950095455 3:10326893-10326915 CTCTGGGCCTGGAGAAGGGAAGG + Exonic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950483492 3:13259182-13259204 CCCAGGGCCTGCATGGCAGAGGG - Intergenic
951982514 3:28581278-28581300 CTCAGGTCTTGGTGGGCAGAAGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954224974 3:49175528-49175550 CTCTGGGCTTAGGGAGCAGAAGG + Intronic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
954466226 3:50656620-50656642 CTTTGGGCCTGGAAGCGAGAGGG + Intergenic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
956033630 3:65066722-65066744 CTCTGAGGCTGGAGGGTACAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958724400 3:97887148-97887170 CTCTGTTCCTGAAAGGCAGATGG + Intronic
959276131 3:104279249-104279271 CCCTTGGCCTGGAGAGCACATGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962715665 3:138124161-138124183 CTCTTGGCGGGGTGGGCAGAGGG - Exonic
962737496 3:138338924-138338946 CTCAAGGCCTGGGGAGCAGATGG - Intergenic
962867774 3:139461844-139461866 CCATGGGCCTGGCAGGCAGAGGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
965151468 3:164982622-164982644 TTCTGAGCCTGGGTGGCAGAGGG - Intronic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
966953419 3:184846657-184846679 CTCTGTGCCTGGAAGGCAAGCGG + Intronic
967743917 3:193033628-193033650 CTTTGGCCCTGCAGTGCAGAGGG + Intergenic
968292676 3:197550793-197550815 TTCTGGAGCTGGGGGGCAGATGG - Intronic
969304373 4:6317429-6317451 CTCTGGGCCTGGAGGCACCAGGG - Intergenic
969605780 4:8201611-8201633 GGCTGGGCCTGCAGGGCTGAGGG + Intronic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
976744654 4:88391155-88391177 CTCAGAGCCTGTAGGGAAGAAGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977155410 4:93566727-93566749 CACTCAGGCTGGAGGGCAGAGGG - Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
980750136 4:137077247-137077269 CTCTGAGCCTGCAGGGATGAGGG + Intergenic
980866657 4:138561087-138561109 GTTTAGGCTTGGAGGGCAGATGG - Intergenic
981936990 4:150249333-150249355 CTCTAGTCCTGAGGGGCAGAGGG + Intronic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984203622 4:176758943-176758965 CACTGGCCCTGGATGGCAGTGGG - Intronic
985521158 5:374423-374445 GGCTGAGCCTGGAGGGCAGGAGG + Intronic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985959879 5:3293404-3293426 GTCTGGGCTTTGAGGGCACATGG + Intergenic
986199635 5:5569510-5569532 CCCCCAGCCTGGAGGGCAGATGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995581410 5:113606685-113606707 CCCTTGGGCTGGAGGGCACATGG + Intergenic
996557332 5:124792521-124792543 CTCTTGGCCTGGGTGACAGAGGG - Intergenic
996599791 5:125249545-125249567 CTCTGTGCCTGGACTGCAGCAGG - Intergenic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
999245046 5:150149700-150149722 CTCTGGGCCAGGAGGGGCCAGGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999701429 5:154232012-154232034 CTCTCCCCCCGGAGGGCAGAGGG - Intronic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000073825 5:157766133-157766155 CTCTGGGCCTGGGGTGGGGAGGG - Intergenic
1000284384 5:159814698-159814720 GTCAGGGCCTGTGGGGCAGAAGG + Intergenic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1001083487 5:168683890-168683912 CTCTGGGCCTGCAACTCAGAAGG - Intronic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312083 5:178320862-178320884 CTGTGGGCCTGGAGGTCGCATGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002521222 5:179794191-179794213 ACCTGGGCCTAGGGGGCAGAGGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002917093 6:1538160-1538182 CTCAGCCCCCGGAGGGCAGAAGG + Intergenic
1002992001 6:2246389-2246411 CTCAGAGCCGGGAGGGCAGCAGG + Intergenic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004704538 6:18112004-18112026 CTCTATGCCTGGTGGGCACATGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006146034 6:31960278-31960300 CTTTGGGCCTGTAGGTCGGATGG - Exonic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008646961 6:53524285-53524307 TGCTGGGCCTTGAGGCCAGACGG - Intronic
1010236328 6:73577877-73577899 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012654963 6:101805927-101805949 GTCTGAGCCTGGAGTGGAGATGG + Intronic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1017311369 6:152982084-152982106 CTCAGGGCCTGGAGTGGAAAGGG - Intronic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1017749685 6:157479797-157479819 CTCTGGGCCAGGAGGGGACCAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019017619 6:168891312-168891334 CTCTTGTCCTGGATGGCAGCAGG - Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019996532 7:4728089-4728111 CCCTGGCCCTGGATGGCAGCCGG + Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1021760008 7:23894445-23894467 CCCTGGGCCTGGTGGGTATAGGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023911929 7:44562495-44562517 CTCTGGACCTGGAGCACAAAAGG - Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024196611 7:47065251-47065273 CTCTGGCCATGGAATGCAGATGG - Intergenic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024797493 7:53036311-53036333 CTCAGGGGCTTGAAGGCAGAGGG - Exonic
1025292305 7:57740863-57740885 CTCTAGGCCTGAAGGGGTGAAGG - Intergenic
1026019123 7:66694483-66694505 GGCGGGGCCTGGAGGGCAGTGGG + Intronic
1026796542 7:73369473-73369495 CTCTGGGCCTGGAGAGGCGTGGG - Intergenic
1026869617 7:73842324-73842346 CTCTGGGGCTGCAGGGCTGGGGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027646674 7:80809942-80809964 ATCAGGGGCTGGAGGACAGAGGG + Intronic
1031199457 7:118661225-118661247 TTCTGGCCCTGATGGGCAGAGGG + Intergenic
1032197902 7:129799774-129799796 CTCCAGGCCTGGCTGGCAGAAGG - Intergenic
1033832048 7:145266846-145266868 CTCTGGGCCTGTAGGGGGAATGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035236654 7:157501369-157501391 CTCGGGGCCTGAGGAGCAGAAGG + Intergenic
1035253457 7:157612070-157612092 CTCTGGGCCTGGAGGGCTGCAGG - Intronic
1035546556 8:486277-486299 CCCTGGCCCAGGAGGGCAGGTGG + Intergenic
1035676141 8:1457019-1457041 CTCTGGGCCTGCAGATCACAGGG + Intergenic
1036695013 8:10968535-10968557 CCCTAGGCCTGGAGGACAGGAGG - Intronic
1039552510 8:38453294-38453316 CCCTGGGCCTCCAGGGGAGACGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1041204709 8:55487175-55487197 CTCTGGACCTGGGGGACAGGTGG + Intronic
1041238053 8:55824592-55824614 AGCTGGGCCTGGAGGGCAAGTGG + Exonic
1041714430 8:60921448-60921470 CTCTCAGCCGGGAGGGCAGGGGG - Intergenic
1043134128 8:76500311-76500333 CCTTGGGCCTGGAGGGAACATGG - Intergenic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1045261355 8:100577702-100577724 CTCTAGGCCTGAAGGGGCGAGGG + Intronic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1046674761 8:117095035-117095057 CTCTGAGCCTTGGGGGCAGGTGG + Intronic
1048052154 8:130828364-130828386 CCCTTGGCCTGGAGGGCACATGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048514506 8:135093646-135093668 TTCTGGGGCTGCATGGCAGATGG + Intergenic
1048855273 8:138681547-138681569 CTCAGGGCCTAGAGGGCATTAGG - Intronic
1048946141 8:139449305-139449327 CTCTGTCCTTGGATGGCAGAAGG + Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049340626 8:142110584-142110606 CACTGGGCCTGCTGGTCAGAAGG - Intergenic
1049347947 8:142148663-142148685 CTCTGGGGCCGAAGGCCAGATGG + Intergenic
1049565889 8:143338808-143338830 GTCTGGGCCTGCAGACCAGAAGG + Intronic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1053354126 9:37432168-37432190 CACTGGTCCTGCAGGGCAGCAGG - Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053586539 9:39464476-39464498 TTCAGGCCCGGGAGGGCAGACGG + Intergenic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1054164194 9:61704849-61704871 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1054450458 9:65401105-65401127 CTGTGGGCCTGGAGGGCCCCGGG - Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1054579768 9:66900757-66900779 TTCAGGCCCGGGAGGGCAGACGG - Exonic
1056489217 9:87088325-87088347 CTCTCAGCCTCAAGGGCAGATGG - Intergenic
1056586515 9:87930987-87931009 ATCTGGGGCTGTAGGGCAGCTGG + Intergenic
1056610363 9:88121955-88121977 ATCTGGGGCTGTAGGGCAGCTGG - Intergenic
1056899117 9:90582433-90582455 CTCTGGCCCTGCAGGGGACAGGG - Intergenic
1057272573 9:93659159-93659181 CCCTGGGCCTTGAGGCCTGACGG - Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060774299 9:126359521-126359543 CTCTGGGCCTGGATGTGGGAAGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061152714 9:128837923-128837945 CTCTAAGCTGGGAGGGCAGAGGG - Intronic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061421983 9:130477622-130477644 CTCTTGGCCTGGAGGAAGGATGG + Intronic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061885753 9:133590323-133590345 TTCAGGGCCTGGAAGGCGGACGG + Intergenic
1062139196 9:134946035-134946057 CTCTGGGCCCTGAGCGGAGAGGG - Intergenic
1062217153 9:135395396-135395418 GTCTGGGCCTGGAGCCAAGACGG + Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062343403 9:136103763-136103785 CTCCGGGCCGGGGGTGCAGACGG + Intergenic
1062496908 9:136836255-136836277 CTCTGGTCCTCGATAGCAGAGGG + Intronic
1062517451 9:136943707-136943729 CTCAGAGCTTGGAGGCCAGAGGG - Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1186929040 X:14367855-14367877 CTCTCTTCCTGGATGGCAGATGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193376228 X:80765105-80765127 CTCTAGGCCAGCAGAGCAGAAGG - Intronic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198447624 X:136733980-136734002 ATCTGGCCCTGAAGGGCAGATGG + Intronic
1198544888 X:137680852-137680874 TTCTGGGCCAGGATGGCAAAAGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic