ID: 1120190160

View in Genome Browser
Species Human (GRCh38)
Location 14:81433424-81433446
Sequence TTGGGACTTTATCCATTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120190160_1120190165 -2 Left 1120190160 14:81433424-81433446 CCTGCCAATGGATAAAGTCCCAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1120190165 14:81433445-81433467 AATCCCCTGGCACCCGACCCAGG 0: 1
1: 0
2: 2
3: 8
4: 100
1120190160_1120190175 21 Left 1120190160 14:81433424-81433446 CCTGCCAATGGATAAAGTCCCAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1120190175 14:81433468-81433490 GTCCTTCATCATCTGCCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 166
1120190160_1120190166 -1 Left 1120190160 14:81433424-81433446 CCTGCCAATGGATAAAGTCCCAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1120190166 14:81433446-81433468 ATCCCCTGGCACCCGACCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 122
1120190160_1120190174 20 Left 1120190160 14:81433424-81433446 CCTGCCAATGGATAAAGTCCCAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1120190174 14:81433467-81433489 GGTCCTTCATCATCTGCCACTGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120190160 Original CRISPR TTGGGACTTTATCCATTGGC AGG (reversed) Intronic
903430285 1:23292795-23292817 TAGGGGCTTCATCCATTGGTTGG - Intergenic
905201532 1:36320046-36320068 TAGGGACTTTATCCATAGGTGGG - Exonic
912850102 1:113116403-113116425 TTGTGTATATATCCATTGGCAGG - Exonic
917683828 1:177395627-177395649 TTCGGAGTTTATCCAGGGGCAGG + Intergenic
920419244 1:205819454-205819476 TTGGAACCTTGTCCATTTGCTGG + Intergenic
1063740777 10:8816621-8816643 TTGGTTCTCTATCCATTGGGAGG - Intergenic
1066569026 10:36751619-36751641 TTGGGCCTGGAACCATTGGCCGG - Intergenic
1069699561 10:70412166-70412188 CTGGGACTTTCTCCGTTGGAGGG - Intronic
1072541485 10:96401616-96401638 TTGGGACTTTTGCCATTTGTTGG - Intronic
1072562471 10:96588578-96588600 TTTGGACTTTATCCTTTAGCAGG - Intergenic
1073952137 10:108821902-108821924 CTGGAACTCTATCCATTGTCTGG + Intergenic
1074228160 10:111507789-111507811 TTGGGAAGTTGTCCAATGGCAGG - Intergenic
1080353371 11:31411823-31411845 TTGGGACTTTATATATTTGGGGG + Intronic
1081274758 11:41134687-41134709 TGGGCACTTCATCCAATGGCTGG - Intronic
1084632659 11:70364403-70364425 TTGAGACTTTTTACACTGGCTGG + Intronic
1089514864 11:119026076-119026098 CCGGGACTGTATCCATAGGCGGG - Exonic
1092042145 12:5394386-5394408 ATGGGCCTCAATCCATTGGCAGG + Intergenic
1100569987 12:95838258-95838280 TTGGGGTTTTATACCTTGGCAGG + Intergenic
1102218157 12:111176585-111176607 TGGGGACTTTATTCAGTGCCAGG + Intronic
1104432453 12:128727648-128727670 TTGGGGTTTTATACATTGGCAGG + Intergenic
1105632707 13:22186919-22186941 TTGGAACTTTATCACTTGTCTGG + Intergenic
1109899631 13:68749480-68749502 TTAGGACTTTAACAATTGGAGGG - Intergenic
1119989233 14:79176446-79176468 TTGGGATTTTATCCTGTAGCTGG - Intronic
1120190160 14:81433424-81433446 TTGGGACTTTATCCATTGGCAGG - Intronic
1127402185 15:58600131-58600153 TTGGCACATTATCCATTTGAGGG - Intronic
1129310239 15:74702555-74702577 TTGGGACTTTAATTATTGCCTGG - Intergenic
1132316408 15:100893506-100893528 CCGGGACTTTATTCATTGGGCGG + Intronic
1133519125 16:6539951-6539973 TTGGTAATTTTTTCATTGGCTGG - Intronic
1137936758 16:52642260-52642282 GTGGACCTTTATCCATTGGAGGG + Intergenic
1144622528 17:16826970-16826992 CTGTGACTTCATCCACTGGCTGG - Intergenic
1144883900 17:18445740-18445762 CTGTGACTTCATCCACTGGCTGG + Intergenic
1145148332 17:20498637-20498659 CTGTGACTTCATCCACTGGCTGG - Intergenic
1148667713 17:49387205-49387227 TTTGCACTTTATCCTGTGGCAGG - Intronic
1149539856 17:57460726-57460748 CTTGTACTTTATCCATAGGCAGG + Intronic
1150831614 17:68526178-68526200 TTGGAAATCTATCCATTTGCTGG + Intronic
1153102470 18:1489128-1489150 TTGGCACCTTATCCAATAGCTGG + Intergenic
1153567992 18:6439389-6439411 TTGGGTTTTTATCCATTGAAGGG + Intergenic
1168376125 19:55881269-55881291 TTGGGACTTTATTTATTTTCTGG + Intronic
926321840 2:11753942-11753964 TTGTGACTTTATCCAGTGCTGGG + Intronic
942488188 2:176461454-176461476 TTGGGGCCTTCTCCATGGGCCGG + Intergenic
1169405917 20:5321143-5321165 TTGGGTCTTTCTCCATAGACAGG - Intergenic
1180666563 22:17517590-17517612 TTGGGTCTTTTTCTAATGGCCGG + Intronic
1181523347 22:23462199-23462221 TGGAGACTTCATCCATAGGCTGG - Intergenic
1181523371 22:23462296-23462318 TGGGGGCTTCATCCATGGGCTGG - Intergenic
1181523409 22:23462414-23462436 TGGGGGCTTCATCCATGGGCTGG - Intergenic
1181523427 22:23462491-23462513 TGGGGACTTCATCCATGGGCTGG - Intergenic
1181828731 22:25541470-25541492 TTTGGTCTCTTTCCATTGGCTGG - Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956786519 3:72647400-72647422 TGGTGACTTTATTCATTGGATGG + Intergenic
956941779 3:74170455-74170477 TTTGGGCATTATCCATTGGCTGG + Intergenic
957088266 3:75703337-75703359 TTGGGTCTCACTCCATTGGCTGG - Intergenic
957315551 3:78571322-78571344 TTGGGAATTTTTCCATCTGCAGG - Intergenic
957840406 3:85661256-85661278 TTGTGACTTTTTACAATGGCTGG + Intronic
958169620 3:89922457-89922479 TTGGGAAATTCTCCATTTGCAGG - Intergenic
962125864 3:132617127-132617149 ATGGGACAATATCCAATGGCAGG - Intronic
963004699 3:140715541-140715563 TTGGGACTTTTTCCTTTGATTGG + Intergenic
963919047 3:150888293-150888315 TTGGGCCCTAATCCAGTGGCTGG - Intronic
965301276 3:167008133-167008155 TTTGGACCTTTTCCTTTGGCTGG - Intergenic
965554712 3:170007056-170007078 TTGACTCTTTCTCCATTGGCTGG - Intergenic
965941358 3:174186267-174186289 ATGGGACTTTATAGAATGGCAGG - Intronic
970542701 4:17095618-17095640 TTTGAACTTTATTCATAGGCAGG + Intergenic
972346319 4:38195481-38195503 TTGTGACTTTCTCCAATGCCTGG + Intergenic
976105507 4:81612916-81612938 ATGGGAACTTATCCATTGGTTGG + Intronic
986578903 5:9243370-9243392 GTGGGCCTTAATCCAGTGGCCGG - Intronic
993124464 5:83816168-83816190 TTGGGACTTTAGCCAGTCTCTGG + Intergenic
993635242 5:90334906-90334928 TTTGGACTTCTTCCATTAGCAGG - Intergenic
1000181710 5:158817897-158817919 TTGACACCTTATCCCTTGGCTGG + Intronic
1009994905 6:70886952-70886974 TTGGGACTTTGTCCTTGGGTTGG - Intronic
1016303969 6:142663721-142663743 TTAGGATTTTATACAATGGCAGG - Intergenic
1016708716 6:147144389-147144411 CTGTGAGTTTATTCATTGGCTGG + Intergenic
1017522850 6:155216952-155216974 TTGGGATTTTTTTCATTGCCTGG + Intronic
1020941118 7:14538766-14538788 TTGGCATTTTATGCATTGGAAGG + Intronic
1023079633 7:36514933-36514955 TGGGGACTTTATGCAGTGACTGG - Intronic
1029536605 7:101161043-101161065 TGGGGCCTTTATCCAGTGCCAGG + Exonic
1032400524 7:131621029-131621051 TTGGGCCTTTGTCCATTCTCAGG + Intergenic
1036625984 8:10471951-10471973 TTGGGGTTTTATACGTTGGCAGG + Intergenic
1037577364 8:20220287-20220309 TTGAGACTTTGGACATTGGCTGG + Exonic
1041457159 8:58073693-58073715 TTGGAACTGTTTGCATTGGCAGG + Intronic
1050868208 9:10531244-10531266 TTAAAATTTTATCCATTGGCCGG - Intronic
1056291609 9:85149211-85149233 TTGGGATTTGATCCAATGTCTGG - Intergenic
1058334543 9:103809709-103809731 TTAGGAATTTATCAGTTGGCTGG - Intergenic
1186320696 X:8421260-8421282 TTGAGACTCTCACCATTGGCAGG + Intergenic
1186505857 X:10091558-10091580 GTGGGTCGTTATCCAATGGCTGG - Intronic
1197726841 X:129782069-129782091 CTGGCACATTCTCCATTGGCAGG - Intronic