ID: 1120190901

View in Genome Browser
Species Human (GRCh38)
Location 14:81438204-81438226
Sequence TCTGGTGTTCCTCCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120190901_1120190911 24 Left 1120190901 14:81438204-81438226 CCTCACCTGGGAGGAACACCAGA No data
Right 1120190911 14:81438251-81438273 TGTGAGGAGAGTTCTTTCATGGG No data
1120190901_1120190909 8 Left 1120190901 14:81438204-81438226 CCTCACCTGGGAGGAACACCAGA No data
Right 1120190909 14:81438235-81438257 GGGGTGGTGTGGACTGTGTGAGG No data
1120190901_1120190910 23 Left 1120190901 14:81438204-81438226 CCTCACCTGGGAGGAACACCAGA No data
Right 1120190910 14:81438250-81438272 GTGTGAGGAGAGTTCTTTCATGG No data
1120190901_1120190906 -8 Left 1120190901 14:81438204-81438226 CCTCACCTGGGAGGAACACCAGA No data
Right 1120190906 14:81438219-81438241 ACACCAGACAGAGCACGGGGTGG No data
1120190901_1120190908 -3 Left 1120190901 14:81438204-81438226 CCTCACCTGGGAGGAACACCAGA No data
Right 1120190908 14:81438224-81438246 AGACAGAGCACGGGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120190901 Original CRISPR TCTGGTGTTCCTCCCAGGTG AGG (reversed) Intergenic
No off target data available for this crispr