ID: 1120192827

View in Genome Browser
Species Human (GRCh38)
Location 14:81454722-81454744
Sequence CAAGTGAAACAGCTTTACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120192826_1120192827 11 Left 1120192826 14:81454688-81454710 CCAGCAAGAGCTATGAAGAGAGA No data
Right 1120192827 14:81454722-81454744 CAAGTGAAACAGCTTTACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120192827 Original CRISPR CAAGTGAAACAGCTTTACGC TGG Intergenic
No off target data available for this crispr