ID: 1120194047

View in Genome Browser
Species Human (GRCh38)
Location 14:81463876-81463898
Sequence CCTTATATGGGAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120194047_1120194058 1 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194058 14:81463900-81463922 CACCTGTTGGCCGGGCATGGTGG No data
1120194047_1120194057 -2 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194057 14:81463897-81463919 GGACACCTGTTGGCCGGGCATGG No data
1120194047_1120194061 28 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194061 14:81463927-81463949 CACCTGTAATCCCAGCATTTTGG 0: 3865
1: 80658
2: 217963
3: 284981
4: 250431
1120194047_1120194055 -8 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194055 14:81463891-81463913 ATATAAGGACACCTGTTGGCCGG No data
1120194047_1120194062 29 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194062 14:81463928-81463950 ACCTGTAATCCCAGCATTTTGGG 0: 3931
1: 88811
2: 317136
3: 261500
4: 233797
1120194047_1120194056 -7 Left 1120194047 14:81463876-81463898 CCCTCCACCTTTCCCATATAAGG No data
Right 1120194056 14:81463892-81463914 TATAAGGACACCTGTTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120194047 Original CRISPR CCTTATATGGGAAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr