ID: 1120194323

View in Genome Browser
Species Human (GRCh38)
Location 14:81465966-81465988
Sequence CTCCTGCTTTCTTGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120194317_1120194323 6 Left 1120194317 14:81465937-81465959 CCTTGAAGCTGTTTTTCTAGGAG No data
Right 1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG No data
1120194315_1120194323 9 Left 1120194315 14:81465934-81465956 CCTCCTTGAAGCTGTTTTTCTAG No data
Right 1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG No data
1120194314_1120194323 10 Left 1120194314 14:81465933-81465955 CCCTCCTTGAAGCTGTTTTTCTA No data
Right 1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120194323 Original CRISPR CTCCTGCTTTCTTGGGAACA GGG Intergenic
No off target data available for this crispr