ID: 1120197614

View in Genome Browser
Species Human (GRCh38)
Location 14:81502740-81502762
Sequence TTTGAGAAGCTGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 745}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120197614_1120197616 -4 Left 1120197614 14:81502740-81502762 CCTTCCTCAGTCAGCTTCTCAAA 0: 1
1: 0
2: 1
3: 53
4: 745
Right 1120197616 14:81502759-81502781 CAAACATCTCTCTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 125
1120197614_1120197617 7 Left 1120197614 14:81502740-81502762 CCTTCCTCAGTCAGCTTCTCAAA 0: 1
1: 0
2: 1
3: 53
4: 745
Right 1120197617 14:81502770-81502792 CTCGCTGCCTGGATATTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120197614 Original CRISPR TTTGAGAAGCTGACTGAGGA AGG (reversed) Exonic
901550329 1:9991410-9991432 TTTGGGAGGCTGAGTTAGGAAGG - Intergenic
902134143 1:14290669-14290691 TTTGACAAGCTGACAGAAGTAGG - Intergenic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902958284 1:19942132-19942154 TTTGAGAACCAGATTGATGAGGG + Intergenic
902965363 1:19997060-19997082 TTTGATAAGCTGACAGAAGTAGG + Intergenic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903378476 1:22881027-22881049 TTTGAGAGGCTGATGCAGGAGGG + Intronic
903853744 1:26323325-26323347 TTTGAGAGGCTGAGTGAGGCAGG - Intronic
904700144 1:32353120-32353142 TTTGGGAAGCTGACTGGGAGGGG - Intronic
904792046 1:33030033-33030055 TTTTAGAAGTTGATTGTGGAGGG - Intronic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
905843541 1:41206193-41206215 TTTGACAAGTTGACAGAAGAAGG + Intronic
906514592 1:46431534-46431556 GTTGAGGGGCTGACTCAGGATGG + Intergenic
906738024 1:48151146-48151168 TTTGACGAGCTGACAGAAGAAGG + Intergenic
906853935 1:49283526-49283548 TTTGACGAGCTGAGAGAGGAAGG + Intronic
906904965 1:49880145-49880167 TTTGACGAGCTGAGAGAGGAAGG - Intronic
907368405 1:53981294-53981316 TTTGAGAAACTGGGTGATGACGG + Intergenic
907644229 1:56225367-56225389 GTTAAGAAGCTGACTGAGCCGGG - Intergenic
907863625 1:58378164-58378186 TTTGACAAGCTGAGAGAAGAAGG - Intronic
909290054 1:73871091-73871113 TTTGGGAAGCTGAGGCAGGAAGG - Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910074830 1:83264626-83264648 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
910244871 1:85127870-85127892 TTTGGGAGGCTGAGTGAGGTGGG + Intronic
910349592 1:86280579-86280601 TATGATCAGCTGACAGAGGAAGG + Intergenic
910437715 1:87221954-87221976 TTTAAGAATCTCACTGAAGAGGG + Intergenic
910601096 1:89033524-89033546 TTTGACAAGCTGACAGAAGTAGG - Intergenic
911128892 1:94369261-94369283 TTTGACAAGCTGACAGAAGAAGG - Intergenic
911248902 1:95552554-95552576 TTTGAGAAGATGAAAGGGGACGG - Intergenic
911492740 1:98589669-98589691 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
911871200 1:103101519-103101541 TGTGAAAATCTGAGTGAGGAAGG + Intronic
912487328 1:110039525-110039547 TTTGAGAGGCTGAGTAGGGAAGG + Intronic
912803282 1:112735242-112735264 CTTGGGAGGCTGAGTGAGGAAGG + Intergenic
913022277 1:114800141-114800163 TTTGGGAGGCTGAGTGAGGCAGG + Intergenic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
913436624 1:118853371-118853393 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
913931198 1:124966825-124966847 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
915563451 1:156700887-156700909 TTTGAGGAGCAGACTGTGGATGG - Exonic
915644154 1:157255082-157255104 TTTGACAAGTTGACAGAGGAAGG + Intergenic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
915929317 1:160049267-160049289 GTTCAGAAGCAGACTGCGGAAGG - Intronic
916402147 1:164460223-164460245 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
916603320 1:166315868-166315890 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
917378936 1:174382774-174382796 TTTGACAAGCTGAGAGAAGAAGG - Intronic
917706014 1:177634939-177634961 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
918133226 1:181646852-181646874 TTTGGGAACCTGACTGATGGGGG - Intronic
918352887 1:183675901-183675923 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
918624175 1:186638351-186638373 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
919391487 1:196991356-196991378 TTTGATAAGCTGACGGAAGTAGG - Intronic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920172158 1:204078840-204078862 TCAGAGAAGCTGACAGAGGTCGG - Intronic
920241108 1:204551286-204551308 TTTGAGAGGCTGAGGCAGGAGGG - Exonic
920945835 1:210527704-210527726 TTTGAGCACGTGACAGAGGATGG + Intronic
920996489 1:210997169-210997191 TTTGATTAGCTGACAGAAGAAGG + Intronic
921469712 1:215533356-215533378 TTTGACAAGTTGACTGAAGTAGG + Intergenic
922046791 1:221952896-221952918 TTTGACAAGCTGACAGAAGTAGG + Intergenic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
922848265 1:228707815-228707837 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
922900568 1:229133380-229133402 TTTAAGAAGCTGACTTAGCTTGG - Intergenic
924035823 1:239935707-239935729 TTTGAGAGGCTGAGACAGGAGGG - Intergenic
924381234 1:243466750-243466772 GTAGACAAGCTGACTAAGGAAGG + Intronic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063554216 10:7063019-7063041 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1063909515 10:10815066-10815088 TTTGAGAAGATCACTGGAGAGGG + Intergenic
1064219651 10:13429763-13429785 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1064689219 10:17896686-17896708 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1064761785 10:18628412-18628434 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
1065230936 10:23598078-23598100 TTTGACAAGCTGACAGAAGTAGG - Intergenic
1065676735 10:28183544-28183566 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1066159800 10:32715550-32715572 TTTGACAAGCTGACAGAAGTAGG + Intronic
1066338834 10:34508950-34508972 TTTGAGTACCTGCCTCAGGATGG - Intronic
1066957666 10:42188397-42188419 TTTGAGCAGTTGACACAGGAAGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067467375 10:46511068-46511090 TGCGATAAGCTGACTCAGGATGG - Intergenic
1067619811 10:47873537-47873559 TGCGATAAGCTGACTCAGGATGG + Intergenic
1068073591 10:52226064-52226086 TTATAGATGCTGGCTGAGGATGG - Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1069455272 10:68548970-68548992 TTTGGGAGGCTGAGTCAGGAGGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070311775 10:75279031-75279053 TTTGGGAAGCTGTCTGTGGCTGG + Intergenic
1070349404 10:75577037-75577059 TTTGATGAGCTGACAGAAGAAGG + Intronic
1071074705 10:81736094-81736116 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1071077455 10:81772200-81772222 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1071248661 10:83792014-83792036 TTTGAGAAGCTCTCTGATGCTGG - Intergenic
1071349766 10:84728278-84728300 TTTGATAAGCTGACAGAAGTAGG + Intergenic
1072029468 10:91504284-91504306 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1072143217 10:92609062-92609084 TTTGAGAAACTTACTGATAATGG + Exonic
1072736121 10:97880859-97880881 CTTGAGCAGCTGATTGATGATGG - Intronic
1072762194 10:98065873-98065895 TCTATGAAGCTGCCTGAGGAAGG + Intergenic
1073089263 10:100920435-100920457 TTTCAGAGGCTGACTTATGATGG + Intronic
1073333463 10:102686752-102686774 TTTGATAATCAGACTGAGCACGG - Intronic
1073782044 10:106849570-106849592 TTTGACGAGCTGAGAGAGGAAGG - Intronic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074249503 10:111730561-111730583 ATTGTAAAGCTGTCTGAGGACGG + Intergenic
1074254562 10:111787843-111787865 TTTTAGAATCTGACTGAGCCTGG + Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1075034449 10:119052480-119052502 CTTGGGAGGCTGACTGAGGTGGG - Intronic
1075199122 10:120387542-120387564 TATGTGAAGATGACTCAGGATGG + Intergenic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077387099 11:2275197-2275219 TTTGAGGAGCTGCAGGAGGATGG - Intergenic
1077450350 11:2639198-2639220 TTTGACAAGTTGAGAGAGGAAGG - Intronic
1079036507 11:17024750-17024772 TCTGGGAAGCTGACTGAGCCTGG - Intergenic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080346744 11:31334371-31334393 TTTGACAAGCTGACAGAAGTAGG - Intronic
1080520401 11:33063626-33063648 TTTAAGAAGATGACTAAGAAGGG + Intronic
1080595001 11:33764942-33764964 TTTGAGACGGTCACTCAGGATGG - Intronic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081169356 11:39847676-39847698 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1081904173 11:46656119-46656141 TTTGAGCAGATGAGTAAGGAAGG + Intronic
1082136805 11:48558566-48558588 TTTGATGAGCTGACAGAAGAGGG - Intergenic
1082227585 11:49726306-49726328 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1082232075 11:49780108-49780130 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1082599689 11:55133855-55133877 TTTGACAAGTTGACAGAAGAAGG + Intergenic
1082614176 11:55338464-55338486 TTTGATGAGCTGACAGAAGAGGG - Intergenic
1083254404 11:61487276-61487298 TTTGAGAAACAGACTGAGACTGG + Intronic
1084235762 11:67787111-67787133 TTTGAGCAACTGACTGTTGATGG + Intergenic
1084353388 11:68620043-68620065 TTTGGGAAGCTGAGGAAGGAGGG + Intergenic
1084626521 11:70312084-70312106 TTTGAGAAGCTGAGGCAGGCAGG - Intronic
1085082030 11:73643048-73643070 TTTGGGAAGCTGAGGAAGGAGGG + Intergenic
1085380814 11:76116244-76116266 TTTGGGAAGGTGGCTGAGCAAGG + Intronic
1085429211 11:76432451-76432473 TTTGAGAAAATGACTGATGCAGG - Intergenic
1085536450 11:77223208-77223230 TTTGACAAGCTGACAGAAGTAGG - Intronic
1086519864 11:87657544-87657566 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1086548651 11:88028386-88028408 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1086645104 11:89210118-89210140 TTTGACAAGTTGACTGAAGTAGG + Intronic
1086653188 11:89318240-89318262 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1087096302 11:94322305-94322327 TTTGGGAGGCTGAGTGAGGTGGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087228493 11:95631308-95631330 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1087548023 11:99609353-99609375 TCTGAGCATCTGACTAAGGAAGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087824182 11:102746424-102746446 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1088012258 11:105017314-105017336 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1088116749 11:106321145-106321167 ATTGTGGAGCTGACTGAAGATGG - Intergenic
1088371297 11:109091063-109091085 TTTGGGAATCTGACTGAGCCTGG + Intergenic
1088432326 11:109772425-109772447 TTAGAGTATTTGACTGAGGAAGG - Intergenic
1088663519 11:112072300-112072322 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1088782737 11:113151858-113151880 GCTGAGAAGCTGACTTGGGAAGG + Intronic
1088866633 11:113853765-113853787 CTTGGGAGGCTGACTGAGGTGGG + Intronic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089422490 11:118342276-118342298 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1090050194 11:123371202-123371224 GTTGAGAGGGTGACTGAGAAAGG + Intergenic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1090761756 11:129843185-129843207 TTTGGGAGGCTGACTGAGGCAGG - Intronic
1090840905 11:130486930-130486952 TCTAAGAAGCTGCCTGAGTAAGG - Intergenic
1091226730 11:133961425-133961447 ATTGGGAGGCTGAGTGAGGATGG - Intergenic
1091298485 11:134489797-134489819 TGTCAGAAGTTGTCTGAGGAGGG - Intergenic
1092006449 12:5074327-5074349 TTTGAGAACCTGAATGATGCTGG + Intergenic
1092628076 12:10349427-10349449 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1092657997 12:10707510-10707532 TTAGAGAAGCTGGCAGTGGAAGG - Intronic
1092707342 12:11298676-11298698 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1092730030 12:11522666-11522688 TTTGGGAAGCTGAGGCAGGATGG + Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093501378 12:19815647-19815669 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1093988347 12:25563129-25563151 TTTGACAAGTTGACAGAAGAAGG - Intronic
1094026783 12:25968077-25968099 TGTAAGAAGCTGGCTGAGAAAGG - Intronic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095388110 12:41673465-41673487 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1095943293 12:47739956-47739978 TTTGGGGAGCTGGCTGAGGAAGG - Intronic
1096137486 12:49214683-49214705 TTTGGGAGACTGACTGAGGTGGG - Intronic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1096331235 12:50714834-50714856 CTTCAGAGGCTGACAGAGGATGG + Intronic
1096600756 12:52727130-52727152 TTTGAGTAGCGTACTGAGGGAGG + Intergenic
1097236409 12:57543051-57543073 GTTAAGAAGGTGACTGAGGCTGG + Intronic
1097701120 12:62820920-62820942 TTTGACAAGCTGACAGAAGTAGG + Intronic
1098186442 12:67901224-67901246 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1098615659 12:72519628-72519650 TTTGACGAGCTGAGAGAGGAAGG - Intronic
1098767457 12:74508506-74508528 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1098871570 12:75822686-75822708 TGTAAGGAGCAGACTGAGGAAGG + Intergenic
1099058445 12:77874451-77874473 TTTGAGAGGCTGAGGCAGGAAGG - Intronic
1099596175 12:84669260-84669282 TTTGAGAAGGTGATGGAGTATGG - Intergenic
1099856615 12:88176531-88176553 TTTGGGAGGCTGACACAGGAGGG + Intronic
1100164489 12:91901064-91901086 CTTGAGAAGCTGTGAGAGGAGGG + Intergenic
1100238238 12:92683183-92683205 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1100463547 12:94823931-94823953 TTTGACAAGCTGACAGAAGTAGG + Intergenic
1100792410 12:98145024-98145046 TTTGGGATGCTTACTGAGAAAGG + Intergenic
1100982295 12:100171274-100171296 TAAAAGAAGGTGACTGAGGATGG + Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101984779 12:109437179-109437201 TTTGAGAACATGACTGGGGAGGG - Intronic
1102274933 12:111574533-111574555 CTTGGGAGGCTGACTCAGGAGGG - Intronic
1102409299 12:112703386-112703408 TTGGGGAATCTGACTAAGGATGG - Intronic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104178880 12:126358478-126358500 TTGGAGAAGCTGCCTGAAAATGG - Intergenic
1104333213 12:127866875-127866897 TTTGATAAGCTGAGAGAAGAAGG + Intergenic
1104626320 12:130358589-130358611 TTTGAGGAGCTGACTGGTGGCGG - Intronic
1104872469 12:132009769-132009791 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
1105338607 13:19497807-19497829 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1106174610 13:27319349-27319371 TTTGAGAGGCTGACGCAGGAGGG - Intergenic
1106675312 13:31952435-31952457 TTGGACAAGTTTACTGAGGATGG + Intergenic
1107047833 13:36013212-36013234 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1107370461 13:39741256-39741278 TTTGACAAGCTGACAGAAGTAGG + Intronic
1108607581 13:52054956-52054978 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1109921246 13:69062671-69062693 TATGTGCAGCTGATTGAGGAAGG - Intergenic
1110030842 13:70611207-70611229 TTTCAGTAGCTCACTGAGAAGGG - Intergenic
1112186700 13:97134631-97134653 TGTGAGAAGCGGACTGTGGTGGG - Intergenic
1112583860 13:100699114-100699136 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1112769449 13:102780023-102780045 TTTGTGAAACTGACTTAGCAGGG + Intergenic
1113626515 13:111851994-111852016 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1113862096 13:113493210-113493232 TTTAGGAACCTGATTGAGGAAGG + Intronic
1115059755 14:29174212-29174234 TATGAGCAGTTGACAGAGGAAGG + Intergenic
1115294558 14:31811609-31811631 TTTGACAAGCTGACAGAAGTAGG - Intronic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1116156628 14:41214320-41214342 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1116286004 14:42972502-42972524 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1116807581 14:49508854-49508876 TTTGGGAGGCTGACTGAGGCGGG + Intergenic
1117143434 14:52812504-52812526 TTTGGGAAGCTGAGGTAGGAAGG + Intergenic
1117373343 14:55098657-55098679 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1117797682 14:59410593-59410615 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1118031113 14:61818785-61818807 TTTGAAAAGCTGACTAAGCCTGG + Intergenic
1118187894 14:63554242-63554264 CTTGGGAGGCTGACTGAGGCAGG - Intergenic
1119307573 14:73620155-73620177 TTTGGGAGGCTGAGTGAGGTAGG - Intergenic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120253366 14:82088202-82088224 TGTGAGAATCTGACAGAGGAAGG - Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120709653 14:87780436-87780458 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1121993722 14:98585397-98585419 TTTGAAAATCTGACTCAGGTTGG - Intergenic
1122248492 14:100421398-100421420 TTTGGGAAGCTCACAGAAGAGGG + Intronic
1122391556 14:101391328-101391350 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1123756417 15:23400752-23400774 CTTGGGAGGCTGAGTGAGGAGGG + Intergenic
1124257769 15:28159716-28159738 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1124838770 15:33221962-33221984 CTTGGGAGGCTGACTGAGGTGGG + Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125358863 15:38845191-38845213 TTTGGGAAGCTGAGGTAGGAGGG + Intergenic
1125663691 15:41414129-41414151 TCTGGGAAGCTGACTCAAGAGGG + Intronic
1126005567 15:44253043-44253065 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126677618 15:51173997-51174019 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1126836523 15:52672092-52672114 TTTGAGAGGCTGAGCCAGGAGGG + Intronic
1126870384 15:52980916-52980938 TTTGAGAACATGAGTGTGGAGGG - Intergenic
1127482184 15:59387768-59387790 TTTGAGAAACTGTCCTAGGAAGG - Intronic
1127599618 15:60522465-60522487 TTTGAGAGGCTGAGGCAGGAAGG + Intronic
1127650958 15:61006613-61006635 TTTCAGAGGCTGGCAGAGGAAGG - Intronic
1128654432 15:69450181-69450203 TTTGAGAGGCTGAAACAGGATGG + Intergenic
1128981210 15:72187758-72187780 TTTCAGAGGCTGGCTGAGGCTGG - Intronic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1130198031 15:81798951-81798973 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1130714979 15:86324815-86324837 TTTGAGAAGGTGAGTGAAGTGGG + Intronic
1130826576 15:87553297-87553319 TTTGGGAGGCTGACTGAGGCGGG - Intergenic
1130886247 15:88094945-88094967 ATTGAACAGCTAACTGAGGATGG + Intronic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131904955 15:97133177-97133199 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1132218418 15:100085000-100085022 TTTGATGAGCTGACAGAAGAAGG + Intronic
1132265275 15:100464890-100464912 TTGCAGATGCTGACTGAGAATGG + Intronic
1132427198 15:101727762-101727784 TATGACCAGTTGACTGAGGAAGG + Intergenic
1133171245 16:3983684-3983706 TTTGGGAGGCTGACGTAGGAGGG + Intronic
1133640616 16:7713540-7713562 TTTGGGAAAATGAGTGAGGAAGG - Intergenic
1133657419 16:7879420-7879442 TCTGAGAGGCTGAGAGAGGAGGG - Intergenic
1133853863 16:9531197-9531219 TTTTAGAAGCTCAGTGAAGATGG + Intergenic
1134355058 16:13474704-13474726 TTAGAGCAGCTCACTGGGGAAGG + Intergenic
1134636394 16:15795059-15795081 TTTGGGAGGCTGACTGAGGTGGG + Intronic
1134693545 16:16206614-16206636 TTTCAGAAGCTGACGGAGCCTGG + Intronic
1134978306 16:18588086-18588108 TTTCAGAAGCTGACGGAGCCTGG - Intergenic
1135009038 16:18856578-18856600 TTTGAGATGCTGACGGGGGGTGG - Intronic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1136505761 16:30702193-30702215 TTTGAGAGGCTGAGTAAGGCGGG - Intronic
1136991720 16:35155840-35155862 TTCTAGAAGATGACTGAGGTGGG - Intergenic
1137025504 16:35469692-35469714 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1137046238 16:35664899-35664921 TTTGACAAGCTGACAGAAGTAGG + Intergenic
1137656804 16:50166721-50166743 TGTGGGATGCTGACTGAGGTGGG - Intronic
1137987293 16:53119981-53120003 TTTGGGAGGCTGACGCAGGAGGG + Intronic
1138448643 16:57079774-57079796 TTTGAGAGGATGTCTGAGTAAGG - Intronic
1138951635 16:61919322-61919344 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1138958190 16:61996825-61996847 TTTGAGAGGCTGAGTGAGGTCGG - Intronic
1139298976 16:65927841-65927863 TTTGACAAGCTGACAGAAGTAGG + Intergenic
1139620572 16:68137860-68137882 TTTGGGAGGCCGACCGAGGAGGG - Intronic
1139822099 16:69728812-69728834 GTTAACAAGATGACTGAGGATGG - Intergenic
1140041368 16:71410420-71410442 TAAGAGGAGCTGACTGAGGCTGG - Intergenic
1140173188 16:72628294-72628316 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1141396487 16:83709617-83709639 TTTAAGAGGCTCACTGTGGATGG - Intronic
1141759954 16:86021691-86021713 TTTGAGAGGCCGACAGAGGCAGG - Intergenic
1141794737 16:86263188-86263210 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1142683983 17:1566697-1566719 CTTGAGAAACTGAGAGAGGACGG - Intergenic
1143040070 17:4027924-4027946 TCTGAGAGGCTGAGTGAGGTGGG - Intronic
1144376895 17:14651861-14651883 TGTGTGTAGCTGACTGAGAAAGG + Intergenic
1144887098 17:18470785-18470807 GATGAGAAGGTGACTGAGAAGGG - Intergenic
1145145118 17:20473510-20473532 GATGAGAAGGTGACTGAGAAGGG + Intergenic
1145985188 17:29041311-29041333 TTTGGGAGGCTGAGTCAGGAAGG - Intronic
1146353818 17:32117860-32117882 GATGAGAAGGTGACTGAGAAGGG - Intergenic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146600839 17:34214735-34214757 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1146752607 17:35394960-35394982 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1147319786 17:39639178-39639200 TTTCATAAGTTGCCTGAGGATGG + Intronic
1147505845 17:41016627-41016649 TGTGAGAATCTGTCTGAGGTGGG - Intronic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148058396 17:44816611-44816633 CTCGAGAAGCTGACTGAGGCAGG - Intronic
1149255529 17:54821805-54821827 TTTGACAAGCTGACAGAAGTAGG + Intergenic
1149342352 17:55699789-55699811 TTTGATAATCTGATTGTGGAAGG + Intergenic
1149786421 17:59439391-59439413 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1149864671 17:60144618-60144640 TTTGAGAGGCTGAGGCAGGAAGG - Intergenic
1149942564 17:60886429-60886451 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1149961194 17:61111243-61111265 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1150596181 17:66607683-66607705 TGTGAGAAGCTAACAGAGGGTGG - Intronic
1150879131 17:69004102-69004124 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1151083623 17:71356932-71356954 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1152209976 17:78997908-78997930 CGTGGGAAGCTGAGTGAGGAAGG + Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153105445 18:1521173-1521195 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1153164712 18:2248192-2248214 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1155044396 18:22091077-22091099 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1155321500 18:24624032-24624054 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1155897923 18:31352954-31352976 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1156044374 18:32861641-32861663 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1156060906 18:33075009-33075031 TGTGAGAAGGTGAAAGAGGATGG + Intronic
1156840408 18:41604203-41604225 TTTGGGAAGCTGAGACAGGAGGG + Intergenic
1156843169 18:41632761-41632783 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1156860716 18:41833238-41833260 CTTTAGAAGCTGTTTGAGGAGGG - Intergenic
1156986962 18:43360277-43360299 TTTGGGAAGCTGAGGTAGGAAGG - Intergenic
1157267279 18:46237151-46237173 TAACAGAAGCTGACTGAGCATGG - Intronic
1157724130 18:49950412-49950434 TTTTAGAAGCAGATTGATGATGG - Intronic
1159072192 18:63637873-63637895 TTTGTGGAGGTCACTGAGGAGGG - Exonic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1159718184 18:71851118-71851140 TGGGTGAAGCTGACTGAGAAAGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160748449 19:722546-722568 TTTGAGAAGCTGCCTCTGGCTGG + Intronic
1161263860 19:3353819-3353841 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1161628905 19:5341455-5341477 TGTAAGAAGCTGGCTGAGGCGGG - Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163171000 19:15530997-15531019 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1164922197 19:32096666-32096688 TCTGAGTACCTGACTGAGGCGGG - Intergenic
1165423418 19:35733150-35733172 TTTGTGAAGATGGCTGGGGAGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166116854 19:40661609-40661631 TTTGGGAGGCTGATTGGGGAGGG - Intergenic
1166187809 19:41153143-41153165 TCTGAGACACTGACTGAGAAGGG + Intergenic
1166598563 19:44072877-44072899 TTTGAGAATCAGGCTGGGGAAGG - Intronic
1166941274 19:46367612-46367634 TTTGAGAAGCAGATTTATGAGGG + Intronic
1168369927 19:55823420-55823442 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
925770520 2:7278193-7278215 TTTGAGAAGCTGAGGTAGGAGGG + Intergenic
926662873 2:15487621-15487643 GTTCAAGAGCTGACTGAGGATGG - Intronic
927235908 2:20874828-20874850 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
927268667 2:21182202-21182224 TGTGGCCAGCTGACTGAGGAAGG - Intergenic
927377456 2:22434960-22434982 TTTGAGAAGCTTAATGTGCAGGG + Intergenic
927998021 2:27500002-27500024 TTTGAGAGGCTGAGCGAGGCAGG - Intronic
928017383 2:27670496-27670518 TTAGGGAAGAAGACTGAGGATGG - Intronic
928261546 2:29771940-29771962 CTCAGGAAGCTGACTGAGGAGGG + Intronic
928477818 2:31648994-31649016 TTTCAGGAGCTGACTGAAGTGGG - Intergenic
928522614 2:32105445-32105467 TTTGACAAGCTGACAGAAGTAGG - Intronic
929105015 2:38356433-38356455 TTTGGGAGGCTGAGTGAGGTGGG - Intronic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
930012742 2:46949781-46949803 TTTGGGAGGCTGAGTCAGGAGGG + Intronic
931205604 2:60142211-60142233 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
931269192 2:60686895-60686917 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
931459000 2:62433913-62433935 TTTGAGGAAATGAGTGAGGAGGG + Intergenic
931481937 2:62650700-62650722 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
931718894 2:65052904-65052926 TTTTAAAAGATGACTGAGGATGG + Intergenic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932980023 2:76652980-76653002 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
932991793 2:76796805-76796827 TTTGACAAGCTGAGTGAAGAAGG + Intronic
933062456 2:77754764-77754786 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
934305786 2:91820911-91820933 TTTGAGCAGTTGACACAGGAAGG + Intergenic
934327470 2:92031831-92031853 TTTGAGCAGTTGACACAGGAAGG - Intergenic
934465857 2:94262411-94262433 TTTGAGCAGTTGACACAGGAAGG - Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935312501 2:101799390-101799412 TTTGAGTAAGTGGCTGAGGAGGG - Intronic
935895803 2:107736166-107736188 TCTGAGAAGCTAACTCAGCACGG + Intergenic
936512870 2:113162499-113162521 TTTGGGAGGCTGGCTGAGGTGGG - Intronic
936730967 2:115381537-115381559 TTTGACAAGCTGAGAGAAGAAGG - Intronic
936762543 2:115804415-115804437 TTTGACAAGTTGAGAGAGGAAGG - Intronic
936912705 2:117609385-117609407 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
937268258 2:120630805-120630827 TTTGTGAAGGAGACTGAGGGTGG - Intergenic
937437907 2:121894527-121894549 TTTAAGGACCTGAGTGAGGAAGG + Intergenic
937944092 2:127315690-127315712 TTTGGGAGGCTGAGTGAGGAAGG + Intronic
938273984 2:129999645-129999667 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938442229 2:131346483-131346505 TTTGACAAGCTGAGAGAAGAAGG - Intronic
938674192 2:133614306-133614328 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938704595 2:133911501-133911523 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938788437 2:134655532-134655554 TTTGACAAGCTGAGAGAAGAAGG - Intronic
938808252 2:134826466-134826488 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
939517745 2:143190449-143190471 TCTGGGAGGTTGACTGAGGATGG + Intronic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
939844812 2:147230128-147230150 TTTGAGAAGCTGAATAGTGAAGG + Intergenic
940380707 2:153012756-153012778 TTTGACGAGCTGACAGAAGAAGG - Intergenic
940441427 2:153720468-153720490 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
940465742 2:154024677-154024699 TTTGACAAGCTGAGAGAAGAAGG - Intronic
940603772 2:155894074-155894096 GTTGAGAAGATGCCTGAGGCTGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941534617 2:166707715-166707737 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
941611523 2:167667932-167667954 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941781911 2:169453922-169453944 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
941870590 2:170381011-170381033 GTTGAGAGGCTGAGTGGGGAGGG + Intronic
942992064 2:182213424-182213446 TTTGACAAGCTGAGAGAAGAAGG + Intronic
943457392 2:188124527-188124549 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
943553183 2:189366719-189366741 TATGGCAAGCTGACTGAAGAAGG + Intergenic
943555277 2:189395798-189395820 TTTGGGAGGCTGAGTGAGGCAGG + Intergenic
943775673 2:191762869-191762891 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
944182147 2:196906608-196906630 TTTGACAAGCTGAGAGAAGAAGG + Intronic
944374872 2:199029614-199029636 TTTGACAAGCTGACAGAAGTAGG + Intergenic
945512158 2:210715936-210715958 TTCCAGAAGCTGATTGATGATGG + Intergenic
945615059 2:212055935-212055957 TTTGACAAGTTGACAGAAGAAGG + Intronic
945812482 2:214565428-214565450 TTTCAGTTGTTGACTGAGGAGGG - Intronic
946468400 2:219932839-219932861 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
947211445 2:227712159-227712181 TTTGGGAAGCTGAAGCAGGAGGG + Intronic
947718960 2:232356258-232356280 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
947887164 2:233582824-233582846 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
948023871 2:234760372-234760394 TTTCAGTAGCTTTCTGAGGAGGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
1169433734 20:5564727-5564749 TTTGAGAGACTGAGTGAGGTGGG + Intronic
1169456458 20:5756774-5756796 TTTGGGAAGCTGATGGAAGACGG - Intronic
1169743747 20:8922099-8922121 TTATAGAAGATGACTGAGGAAGG + Intronic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1171352408 20:24513282-24513304 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1172356972 20:34287068-34287090 TTTGGGAGGCTGCCTGAGGGTGG - Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173755496 20:45512081-45512103 TTTGAGAGGCTGAGTAAGGCAGG - Intergenic
1173993468 20:47320337-47320359 TGTGACAAGGTGACTGTGGAGGG - Intronic
1174223961 20:48981974-48981996 TTTGACAAGCTGACAGAAGTAGG - Intronic
1174262887 20:49309903-49309925 TCTGAGGAGGTGGCTGAGGAAGG - Intergenic
1175072419 20:56345542-56345564 CTTGTGAGGCTGACTGAGGGAGG + Intergenic
1175455049 20:59106151-59106173 TTTGAGGATCAGACTGAGCAGGG + Intergenic
1175963065 20:62646787-62646809 TTTGAGAAGAAGACGGAGGCTGG - Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1176255036 20:64147239-64147261 TTTGAGAAGCTGGGGGAGTAGGG - Intergenic
1176878950 21:14167872-14167894 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1177381526 21:20351021-20351043 TCTGGGAAGCTGACCCAGGAGGG + Intergenic
1177489472 21:21803885-21803907 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1178522040 21:33294600-33294622 TTTGAGCAGCTGATGGAGGGTGG - Intronic
1178880356 21:36445071-36445093 TTTGGGAGGCTGAGTCAGGAGGG - Intergenic
1180233663 21:46443513-46443535 TCTGAGGAGCTGGCTCAGGAGGG - Intronic
1180279777 22:10683057-10683079 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1180586995 22:16901583-16901605 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1181105108 22:20569621-20569643 CCTGGGAAGCTGCCTGAGGAGGG + Intronic
1182126125 22:27817036-27817058 TTTGAGCAGCTGAAACAGGACGG + Intergenic
1184295075 22:43518000-43518022 TTTGGGAGGCTGAGTCAGGAGGG + Intergenic
949381704 3:3454113-3454135 TTTTAGAAGAGAACTGAGGAAGG + Intergenic
949632461 3:5943542-5943564 TTTGACAAGCTGACAGAAGTAGG - Intergenic
949678870 3:6489891-6489913 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950504058 3:13382900-13382922 TTTGGGAAGCTGAGGTAGGAGGG + Intronic
951592415 3:24280594-24280616 TTTGACAAGCTGAGAGAAGAAGG + Intronic
951869699 3:27347657-27347679 TTTGAAAATCTGACTGTGGCTGG - Intronic
952331884 3:32371118-32371140 TTTGGGAGCCTGACTGAGGTGGG + Intergenic
952409178 3:33032193-33032215 CATGGGGAGCTGACTGAGGAGGG - Intronic
953070890 3:39518411-39518433 TTTGAGAAGGTGACTGATGGTGG + Intronic
953108765 3:39911863-39911885 CTTCAGAAGCTGAGTAAGGAGGG - Intronic
953132409 3:40152872-40152894 TTTGGGAGGCTGAGTCAGGAGGG + Intronic
953457364 3:43053834-43053856 TTTAAGAATGTGCCTGAGGAGGG + Intronic
953458953 3:43065787-43065809 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
953499942 3:43423573-43423595 TCTGTGAAGCTGACTGCAGAGGG + Intronic
955365138 3:58304392-58304414 TTTGAGAAAATAATTGAGGAAGG + Intergenic
955630191 3:60965423-60965445 TTTGACAAGTTGAGTGAAGAAGG - Intronic
955884940 3:63587905-63587927 TTTGAGAAAATGACTGTGCATGG - Intronic
956792516 3:72691068-72691090 TTAGAGAACGTGACTAAGGATGG - Intergenic
956812523 3:72877990-72878012 TGTGAGAAGCTGGCCAAGGAAGG - Intergenic
956858626 3:73300745-73300767 TTTGAGAGGCTGAGGGAGGGGGG - Intergenic
956926264 3:73991851-73991873 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
958171339 3:89944074-89944096 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
958205605 3:90387413-90387435 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
958253045 3:91292275-91292297 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
958407601 3:93767959-93767981 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958697578 3:97547049-97547071 TTTGATGAGCTGACAGAAGAAGG - Intronic
958886964 3:99738209-99738231 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959057708 3:101584379-101584401 TTTGGGAAGCTGAGTCAGGAGGG - Intronic
959218436 3:103483157-103483179 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
960744490 3:120872063-120872085 TTTGAAAATCTGACTAATGAAGG - Intergenic
960859925 3:122142078-122142100 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
961303522 3:125937658-125937680 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
961481638 3:127184296-127184318 TTTAAGAAGCTGCCTGAGTGTGG - Intergenic
964126633 3:153240745-153240767 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
964149552 3:153507424-153507446 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
964661299 3:159123432-159123454 TCTTAGAAGCTGACTGGGCAGGG - Intronic
965228812 3:166026085-166026107 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
965386330 3:168050465-168050487 TTTGAGAATTTCACTGAGGTGGG + Intronic
965646115 3:170883545-170883567 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
965647787 3:170902206-170902228 TATGACCAGCTGACTGAGAAAGG + Intronic
966335304 3:178860969-178860991 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
966494236 3:180561085-180561107 TTTGAGAAGTTGACAGAAGTAGG + Intergenic
967105976 3:186255400-186255422 TATAAGAAGGTGACTGAGGCTGG + Intronic
967707933 3:192673962-192673984 TTTGAAAAGCTGTCTGAGTGTGG - Intronic
968612274 4:1562739-1562761 TTCCAGAAGCTGACTGGGGATGG + Intergenic
968687375 4:1970418-1970440 TCTCAGCAGCTGACTCAGGAAGG - Intronic
968837837 4:2978700-2978722 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
970474318 4:16407377-16407399 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
971157943 4:24103273-24103295 GTTGAGGAGCTGATTGAGAAGGG - Intergenic
971447547 4:26767060-26767082 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972634257 4:40869337-40869359 TTTGGGAGGCTGAGTGAGGTAGG + Intronic
972769613 4:42184912-42184934 TTTCAGAAGCTGGCTGTGAAAGG + Intergenic
973318961 4:48790415-48790437 GTTCAGAAGATGACAGAGGAGGG - Intergenic
973325019 4:48851443-48851465 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
973326988 4:48872412-48872434 TTTGGGAGGCCGACTGAGGCAGG - Intergenic
973592524 4:52457541-52457563 TTTGACAAGCTGACAGAAGTAGG - Intergenic
973630730 4:52817477-52817499 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
974493998 4:62603297-62603319 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
974659177 4:64864130-64864152 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
974723414 4:65771124-65771146 TTTGACAAGTTGACAGAAGAAGG - Intergenic
975255975 4:72235854-72235876 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976371991 4:84299799-84299821 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
977170427 4:93754787-93754809 TTTGAGAAGCTGATTATGCAAGG + Intronic
977299336 4:95250097-95250119 TCCTAGAAGCTGACTGAGAAAGG + Intronic
977333365 4:95664862-95664884 TTTGACAAGCTGAGAGAGGAAGG + Intergenic
977653292 4:99493271-99493293 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
977881405 4:102209916-102209938 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
978096785 4:104788006-104788028 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
978149846 4:105420347-105420369 TTTGGGAAGCTGAGACAGGAAGG - Intronic
978209742 4:106120973-106120995 TTTGACAAGCTGAGAGAAGAAGG + Intronic
978517686 4:109586444-109586466 TTTGAGAAGCTGACAGAAGTAGG - Intronic
978587658 4:110291547-110291569 CCTGAGGAGCTGCCTGAGGAGGG + Intergenic
978599149 4:110410406-110410428 TTTGACAAGCTGAGAGAAGAAGG - Intronic
978626593 4:110692647-110692669 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
978706668 4:111721260-111721282 TTTGGGAGGCTGACGGAGAATGG - Intergenic
979634738 4:122944620-122944642 TTTGACAAGTTGAGAGAGGAAGG - Intronic
979666430 4:123316020-123316042 TTTGGGAAGCTGAGGCAGGAGGG - Exonic
979778150 4:124616920-124616942 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
979947292 4:126848972-126848994 TCTGAAAATTTGACTGAGGAGGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980612936 4:135182710-135182732 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
981392210 4:144204385-144204407 GTTTAGAAGCTGACTCAGGCTGG - Intergenic
981839376 4:149093580-149093602 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
981910870 4:149980495-149980517 TTTGAGACTCTGACCTAGGATGG + Intergenic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
982726295 4:158910121-158910143 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
982785568 4:159533030-159533052 TTTGACAAGCTGACAGAAGTAGG - Intergenic
983341346 4:166464336-166464358 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
983359064 4:166705310-166705332 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
983687893 4:170432442-170432464 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984307705 4:178016054-178016076 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
984337049 4:178405527-178405549 TTTGAGAAGCTGATTTATTAAGG - Intergenic
985241644 4:187937101-187937123 TTTGAGAGGCTGAGCGGGGAGGG - Intergenic
985976680 5:3424443-3424465 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
986126980 5:4892558-4892580 TTTGACAAGTTGACAGAAGATGG - Intergenic
987482187 5:18472836-18472858 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
988600978 5:32639231-32639253 TTTGGGAGGCTGACACAGGAAGG - Intergenic
988984402 5:36602780-36602802 TTTCAGAAGAGGACTGAGCAAGG - Intergenic
989158505 5:38367585-38367607 GGTGAGAAGTTGACTGAGAATGG - Intronic
989349811 5:40473738-40473760 TTTGACAAGCTGACAGAAGTAGG - Intergenic
989493057 5:42079302-42079324 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
990037184 5:51335768-51335790 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990750562 5:59011297-59011319 TTTGACAAGCTGAGAGAAGAAGG + Intronic
991234207 5:64375466-64375488 TAAGACAAGTTGACTGAGGAAGG + Intergenic
992309510 5:75481265-75481287 TTTGAGAAGCAGTCTGAAGGTGG - Intronic
992348044 5:75901069-75901091 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
992514359 5:77475828-77475850 TTTGACAAGCTGAGAGAAGAAGG + Intronic
993051745 5:82933460-82933482 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
993094651 5:83467627-83467649 TTTGAGAAAGTGACTAAGGAGGG + Intergenic
993677014 5:90828349-90828371 TTGGAGAATATTACTGAGGAGGG - Intronic
993825762 5:92684706-92684728 TTTGAGAGGCTGTCTCAGAAAGG + Intergenic
994036857 5:95211659-95211681 TTTGACAAGTTGAGTGAAGAAGG - Intronic
994270541 5:97771588-97771610 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
994300002 5:98135993-98136015 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
994547155 5:101181145-101181167 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
995564118 5:113415760-113415782 TTTGACAAGCTGACAGAAGTAGG - Intronic
996100507 5:119440179-119440201 TTTGACAAGCTGACAGAAGTAGG + Intergenic
996518083 5:124395653-124395675 TTTGAGAAGCAGAGTGAGCTGGG - Intergenic
996751633 5:126895294-126895316 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
996753031 5:126908805-126908827 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
996921631 5:128774785-128774807 GTTGATAAGCTGACCGATGACGG + Intronic
996953173 5:129152463-129152485 TTTGAGAAACTGACAGAAGTAGG - Intergenic
997134545 5:131311928-131311950 TTTGACGAGCTGAGTGAAGAAGG - Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997482806 5:134201167-134201189 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
997487089 5:134240386-134240408 TTTCAGAAGCTGAGCGAGAAGGG + Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998490331 5:142540899-142540921 TTTGTGAGGCTGACTAGGGAGGG + Intergenic
999507027 5:152208321-152208343 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
999555930 5:152741957-152741979 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1000355460 5:160390170-160390192 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1202773368 5_GL000208v1_random:34874-34896 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1202775074 5_GL000208v1_random:62433-62455 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1003048660 6:2760961-2760983 TTTAAGATGCTGACTAAAGATGG + Intergenic
1003557965 6:7157661-7157683 TTTGAGAAGCTGAGGTCGGAGGG + Intronic
1003635688 6:7829459-7829481 TTTGGGAGGCTGAGTCAGGAGGG + Intronic
1004053372 6:12110411-12110433 TTTGCTAAGATAACTGAGGAAGG - Intronic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006088854 6:31616035-31616057 TTTCAGCAGGGGACTGAGGAAGG - Intronic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1007484395 6:42170852-42170874 GTGGAGAAGCTGACTGAAGCAGG + Intronic
1008041493 6:46805980-46806002 TTTTAAAAGCTGACTGGCGATGG - Intronic
1008318528 6:50077775-50077797 TTTGAGAAGTTGACAGAAGAAGG - Intergenic
1008361192 6:50620999-50621021 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1008402562 6:51080343-51080365 TTTGAGAAGCTGAGGTGGGAGGG + Intergenic
1008893582 6:56525122-56525144 CTTGAGAAGTTGACTGTGGTTGG - Intronic
1009191445 6:60634772-60634794 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1009771575 6:68150393-68150415 TTTGAGAGTGTGACTGAGGTAGG - Intergenic
1010004811 6:70984053-70984075 TTTGATAAACTGACTTAGGAGGG + Intergenic
1010078663 6:71831694-71831716 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1010523794 6:76876029-76876051 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1010652223 6:78468347-78468369 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1010679705 6:78784150-78784172 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1011315442 6:86026473-86026495 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1012364065 6:98417519-98417541 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1012495111 6:99824598-99824620 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1012605868 6:101157234-101157256 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1012680272 6:102170685-102170707 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1012851547 6:104452450-104452472 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1012854927 6:104490413-104490435 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1013322425 6:109008011-109008033 TGTGAGAAGATAACTTAGGAAGG - Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013762289 6:113532138-113532160 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1014379812 6:120726175-120726197 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1014397809 6:120948036-120948058 TTTGTGAATCTGATTAAGGAAGG - Intergenic
1014605902 6:123473101-123473123 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1015781329 6:136869351-136869373 CTTGAGAGGCTGAGTGAGGCAGG - Intronic
1016174328 6:141060208-141060230 TTTGAGAACCTGGCTGAGGTAGG - Intergenic
1016193650 6:141303536-141303558 TTTGAGAGGCTGAGGTAGGAAGG - Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017203746 6:151783173-151783195 TTTGGGGAGCTGACTGGGGCTGG - Intronic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1019960518 7:4455595-4455617 TTTGGGGAGATGACAGAGGAAGG - Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020593151 7:10168619-10168641 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1020845199 7:13273673-13273695 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1020922287 7:14280017-14280039 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021439596 7:20662802-20662824 TTTGAGAATCTGATTGAGAAAGG + Intronic
1021618741 7:22529317-22529339 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1021767644 7:23965711-23965733 TTTGAGAAGGTGATTTTGGAAGG + Intergenic
1021870450 7:25001239-25001261 TTTGACAAGTTGACAGAGGTAGG - Intergenic
1021901476 7:25290101-25290123 TTTGAGAAGCTGGCAGAGCAGGG + Intergenic
1022084792 7:27056467-27056489 TTTAAGAAGCTGCATGGGGATGG - Intergenic
1022439205 7:30419465-30419487 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1022694065 7:32687675-32687697 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1024022178 7:45382485-45382507 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1025143822 7:56487285-56487307 TTTGGGAGGCTGAGTGGGGAGGG + Intergenic
1025213784 7:57037552-57037574 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1025609113 7:63061244-63061266 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1025650976 7:63468664-63468686 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1025658169 7:63539265-63539287 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1026000217 7:66555349-66555371 TTTGGGAGGCTGCCTGAGGCAGG - Intergenic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026232863 7:68500400-68500422 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1026417606 7:70198348-70198370 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1027292536 7:76729503-76729525 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1028114601 7:86982836-86982858 TTTGACAAGCTGACAGAAGTAGG + Intronic
1028355510 7:89901875-89901897 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1028400391 7:90419179-90419201 TTTGGGAGGCTGAGTGAGGCAGG + Intronic
1029875145 7:103742423-103742445 TTTGACAAGTTGACAGAAGAAGG + Intronic
1029948921 7:104562666-104562688 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1029951867 7:104595030-104595052 TTTGAGAAGTTGACAGAAGTAGG - Intronic
1030444954 7:109637886-109637908 TTTGATAAGATCACTAAGGAGGG + Intergenic
1030725138 7:112917605-112917627 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1030997151 7:116372392-116372414 TTTGACAAGCTGAGAGAGGAAGG + Intronic
1031610642 7:123822714-123822736 TTTGAGAAGCTGAGGGATGAAGG + Intergenic
1031905147 7:127452096-127452118 TTTGATAAGCTGACAGAAGTAGG + Intergenic
1032652486 7:133894413-133894435 TTTGACGAGCTGAGAGAGGAAGG - Intronic
1032881782 7:136098654-136098676 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1032944351 7:136832209-136832231 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1033497811 7:141917313-141917335 TTAGAGAAGCTGAGTGGGAAGGG + Intronic
1033645761 7:143302486-143302508 GTTTAGAAGCTGACTGGGGCAGG - Intronic
1033736934 7:144231868-144231890 TTCCAGGAGATGACTGAGGAGGG + Intergenic
1033746123 7:144319078-144319100 TTCCAGGAGATGACTGAGGAGGG - Intergenic
1034190188 7:149207781-149207803 TCAGAGAGGCTGACAGAGGAGGG + Intronic
1034341061 7:150355629-150355651 TTTGAGACGTTGACTAAAGAGGG - Intergenic
1034623836 7:152477340-152477362 TTTGAGAGGCTGAATGAAGCAGG - Intergenic
1034963238 7:155375032-155375054 TTTGAAAGGCGGACTGAGGGTGG - Intergenic
1035884319 8:3275913-3275935 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1036139365 8:6192224-6192246 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1036407982 8:8471879-8471901 TTTGACGAGCTGACAGAAGAAGG + Intergenic
1036689698 8:10937385-10937407 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1037089151 8:14891817-14891839 GTTAAGATGCTGACTGATGAGGG - Intronic
1037781959 8:21875615-21875637 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1038163229 8:25060482-25060504 TTTGAGAGGCTGAGGCAGGACGG - Intergenic
1038234107 8:25735326-25735348 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1039112576 8:34055923-34055945 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1039195561 8:35027452-35027474 TATTAGAACCTGACTTAGGAAGG - Intergenic
1039317866 8:36393566-36393588 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1039414759 8:37384465-37384487 TTTTTGAAGCTGACTGAGACAGG + Intergenic
1039821779 8:41141398-41141420 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1040083362 8:43312267-43312289 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1040540779 8:48352849-48352871 TTTGACGAGCTGACAGAGGTAGG + Intergenic
1040865580 8:52046320-52046342 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1041774412 8:61508409-61508431 TTTGAGAAGTTGACAGATTATGG - Intronic
1041991505 8:63998334-63998356 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042551485 8:69997586-69997608 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1042781255 8:72493687-72493709 TTTGAGAATTTGACTGTAGAAGG - Intergenic
1043241628 8:77941525-77941547 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1044143775 8:88686726-88686748 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1044266645 8:90189746-90189768 CTTGGTAAGCTGACTGAGGAGGG + Intergenic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044960660 8:97528025-97528047 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1044980036 8:97707508-97707530 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1045088309 8:98711292-98711314 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1045123526 8:99064256-99064278 TTTGAGGAGCTGACAGAATAAGG + Intronic
1045201858 8:99991265-99991287 TTTGACAAGCTGACAGAAGTAGG + Intronic
1046433988 8:114163750-114163772 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1047328661 8:123864965-123864987 TTTGAGGAGCTGAGAGAGGAAGG - Intronic
1047452455 8:124977710-124977732 TTTCCGATGCTGACTGAGGTAGG - Exonic
1047840439 8:128745629-128745651 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1047845675 8:128802368-128802390 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1048149694 8:131882703-131882725 TTTGACAAGCTGACAGAAGTAGG - Intergenic
1048220024 8:132532602-132532624 TTGGAGAGGCTGCCTGAGGCTGG - Intergenic
1048252403 8:132877543-132877565 TTAGAGAATCTGACTGAGCCCGG + Intronic
1049177730 8:141204717-141204739 TTTGAGAGGCTGAGCGAGGCAGG + Intergenic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1050178888 9:2899033-2899055 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1050264930 9:3879965-3879987 TTTGGTCAGCTGACTGAGAAGGG + Intronic
1050310341 9:4346606-4346628 CTAGAGAAGCTGACCAAGGATGG - Intronic
1050599521 9:7236211-7236233 TTTGGGAAGCTGACGGGGGGTGG - Intergenic
1050677162 9:8069318-8069340 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1050688966 9:8203959-8203981 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1050938469 9:11427622-11427644 TGTGAGAAGCTAAATGGGGATGG + Intergenic
1051142797 9:13995916-13995938 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1051702046 9:19834232-19834254 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1051790249 9:20794004-20794026 TTTGAAGGGCTGACTGTGGAAGG - Intronic
1052445226 9:28553155-28553177 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1052640389 9:31159932-31159954 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1052968107 9:34357372-34357394 TTACAGAAACTGACTGAAGAAGG - Intergenic
1052977491 9:34421988-34422010 TTTGAGAGGCTGTCTGGGGATGG - Intronic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053695914 9:40639187-40639209 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1054307161 9:63438405-63438427 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1054345896 9:63914400-63914422 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1054439520 9:65247884-65247906 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1054490887 9:65774055-65774077 TTTGAGCAGTTGACACAGGAAGG + Intergenic
1055241729 9:74194363-74194385 TTTGAGGAGATGATTGATGATGG - Intergenic
1055569838 9:77605410-77605432 TTTGAGAAAATGACAGAGGCAGG + Intronic
1055860719 9:80746651-80746673 TTTGATTAGCTGACAGAAGAAGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1057783376 9:98068569-98068591 TTTGGGAAGCTGAGGTAGGAGGG + Intronic
1057896091 9:98909779-98909801 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG + Intergenic
1058118049 9:101107133-101107155 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1058161013 9:101570865-101570887 TTTGAGAAGCTGGCTGTTTAAGG - Exonic
1058457000 9:105147088-105147110 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1060465886 9:123904375-123904397 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1061156329 9:128863965-128863987 GTTGAGGAGCTGACTAGGGAAGG - Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1202778361 9_KI270717v1_random:12800-12822 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1203363217 Un_KI270442v1:235843-235865 TTTGAGACGCTGGGTCAGGAGGG + Intergenic
1186303686 X:8230043-8230065 TTTGGGAGGCTGAGTGAGGCAGG + Intergenic
1186639913 X:11444511-11444533 TTTGGGAAGCTGTCTCAGCAAGG + Intronic
1186779836 X:12901448-12901470 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1187415844 X:19092660-19092682 TTTAAGATGCTGGGTGAGGAGGG - Intronic
1187491206 X:19753155-19753177 TTTGAAGAGCTGAGTGAGGTTGG + Intronic
1188461331 X:30430357-30430379 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1188684499 X:33053228-33053250 TTTTAGAAGCTTACTAATGAGGG + Intronic
1188946040 X:36303425-36303447 TTTGGGAAGCTGAGTCTGGAGGG - Intronic
1189091751 X:38090817-38090839 TTTTAGAAACTGGCTGAGCAAGG - Intronic
1189914108 X:45839845-45839867 TTTGGGAGGCTGACTGAGACAGG - Intergenic
1190975655 X:55397682-55397704 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1191051294 X:56195232-56195254 TTTGACAAGTTGACAGAGGTAGG + Intergenic
1191079506 X:56494425-56494447 TTTGACAAGTTGACTGAAGTAGG - Intergenic
1191145629 X:57162845-57162867 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1191935969 X:66427274-66427296 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1191981412 X:66929833-66929855 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1192613029 X:72586580-72586602 TTTGACAAGCTGACAGAAGTAGG + Intronic
1192618739 X:72655163-72655185 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1192654842 X:72981845-72981867 TTTGAGAAGTTGACAGAAGTAGG + Intergenic
1192666984 X:73098919-73098941 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1192907377 X:75566259-75566281 TTTGACGAGCTGACAGAAGAAGG - Intergenic
1192909468 X:75587517-75587539 TTTGACAAGCTGACAGAAGAAGG + Intergenic
1192974509 X:76268426-76268448 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1192979807 X:76327775-76327797 TTTGATGAGCTGACAGAAGAAGG - Intergenic
1192984140 X:76378537-76378559 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1193064577 X:77245289-77245311 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1193182168 X:78471213-78471235 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1193281405 X:79655426-79655448 TTTGACAAGCTGACAGAAGTAGG - Intergenic
1193376519 X:80767728-80767750 TTTGACAAGCTGACAGAAGTAGG + Intronic
1193831477 X:86294408-86294430 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1194736078 X:97514494-97514516 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1195254317 X:103078367-103078389 TTTAGGAAGCTGAATGTGGAAGG - Intronic
1195553461 X:106194525-106194547 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1195659719 X:107365358-107365380 TTTGACGAGCTGAGAGAGGAAGG + Intergenic
1196077441 X:111593685-111593707 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1196116014 X:112000295-112000317 TTTTATAAGCTCACTGAGGTTGG - Intronic
1196146829 X:112327163-112327185 TTTGACGAGCTCAGTGAGGAAGG + Intergenic
1197478106 X:126947935-126947957 TTTGAGGAGTTGACAGAAGAAGG + Intergenic
1197596527 X:128470648-128470670 TTTGAGAAGGAGACTGACTAGGG - Intergenic
1199884700 X:152007912-152007934 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1200414885 Y:2899354-2899376 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1200774561 Y:7159091-7159113 TTTGACGAGCTGAGAGAGGAAGG - Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic
1200874505 Y:8139305-8139327 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1201075094 Y:10180880-10180902 TTTGAGACGCTGGTTCAGGAGGG - Intergenic
1201080672 Y:10241952-10241974 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1201193674 Y:11471104-11471126 TTTGAGCAGTTGACACAGGAAGG - Intergenic
1201448429 Y:14083412-14083434 TCTGAACAGCTGACTGAGCAAGG + Intergenic
1201498120 Y:14612280-14612302 TTTGACAAACTGACTGAAGTAGG - Intronic
1201533079 Y:15013816-15013838 TTTGATGAGCTGACAGAAGAAGG + Intergenic