ID: 1120203412

View in Genome Browser
Species Human (GRCh38)
Location 14:81562760-81562782
Sequence GAATCCTGGTTGACTGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120203412_1120203419 25 Left 1120203412 14:81562760-81562782 CCACTAGCAGTCAACCAGGATTC No data
Right 1120203419 14:81562808-81562830 AAGGCATCCTCTGATTAGACTGG No data
1120203412_1120203416 6 Left 1120203412 14:81562760-81562782 CCACTAGCAGTCAACCAGGATTC No data
Right 1120203416 14:81562789-81562811 TTCCCAAAATCGTAACTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120203412 Original CRISPR GAATCCTGGTTGACTGCTAG TGG (reversed) Intergenic
No off target data available for this crispr