ID: 1120205202

View in Genome Browser
Species Human (GRCh38)
Location 14:81580331-81580353
Sequence ACAAAGAGGCTACAATGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120205192_1120205202 19 Left 1120205192 14:81580289-81580311 CCAGACATAGATAAAAGATGGAG No data
Right 1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120205202 Original CRISPR ACAAAGAGGCTACAATGGGA AGG Intergenic
No off target data available for this crispr