ID: 1120205937

View in Genome Browser
Species Human (GRCh38)
Location 14:81587821-81587843
Sequence ACGAATTATGTAGAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120205937_1120205940 11 Left 1120205937 14:81587821-81587843 CCTCCTCCTTCTACATAATTCGT No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205937_1120205941 25 Left 1120205937 14:81587821-81587843 CCTCCTCCTTCTACATAATTCGT No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120205937 Original CRISPR ACGAATTATGTAGAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr