ID: 1120205939

View in Genome Browser
Species Human (GRCh38)
Location 14:81587827-81587849
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120205939_1120205941 19 Left 1120205939 14:81587827-81587849 CCTTCTACATAATTCGTGTCAAA No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data
1120205939_1120205940 5 Left 1120205939 14:81587827-81587849 CCTTCTACATAATTCGTGTCAAA No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120205939 Original CRISPR TTTGACACGAATTATGTAGA AGG (reversed) Intergenic
No off target data available for this crispr