ID: 1120205940

View in Genome Browser
Species Human (GRCh38)
Location 14:81587855-81587877
Sequence AACTTCACTTAGAGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120205938_1120205940 8 Left 1120205938 14:81587824-81587846 CCTCCTTCTACATAATTCGTGTC No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205936_1120205940 12 Left 1120205936 14:81587820-81587842 CCCTCCTCCTTCTACATAATTCG No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205935_1120205940 13 Left 1120205935 14:81587819-81587841 CCCCTCCTCCTTCTACATAATTC No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205939_1120205940 5 Left 1120205939 14:81587827-81587849 CCTTCTACATAATTCGTGTCAAA No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205937_1120205940 11 Left 1120205937 14:81587821-81587843 CCTCCTCCTTCTACATAATTCGT No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data
1120205934_1120205940 17 Left 1120205934 14:81587815-81587837 CCTTCCCCTCCTCCTTCTACATA No data
Right 1120205940 14:81587855-81587877 AACTTCACTTAGAGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120205940 Original CRISPR AACTTCACTTAGAGAGAGAC TGG Intergenic
No off target data available for this crispr