ID: 1120205941

View in Genome Browser
Species Human (GRCh38)
Location 14:81587869-81587891
Sequence AGAGACTGGACATTTCTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120205935_1120205941 27 Left 1120205935 14:81587819-81587841 CCCCTCCTCCTTCTACATAATTC No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data
1120205938_1120205941 22 Left 1120205938 14:81587824-81587846 CCTCCTTCTACATAATTCGTGTC No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data
1120205939_1120205941 19 Left 1120205939 14:81587827-81587849 CCTTCTACATAATTCGTGTCAAA No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data
1120205937_1120205941 25 Left 1120205937 14:81587821-81587843 CCTCCTCCTTCTACATAATTCGT No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data
1120205936_1120205941 26 Left 1120205936 14:81587820-81587842 CCCTCCTCCTTCTACATAATTCG No data
Right 1120205941 14:81587869-81587891 AGAGACTGGACATTTCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120205941 Original CRISPR AGAGACTGGACATTTCTATG AGG Intergenic
No off target data available for this crispr