ID: 1120210211

View in Genome Browser
Species Human (GRCh38)
Location 14:81626803-81626825
Sequence ACCAAAAATGTCTTCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120210208_1120210211 -1 Left 1120210208 14:81626781-81626803 CCTCTCCCTTCAAGTTGCAACAA No data
Right 1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG No data
1120210210_1120210211 -7 Left 1120210210 14:81626787-81626809 CCTTCAAGTTGCAACAACCAAAA No data
Right 1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG No data
1120210207_1120210211 2 Left 1120210207 14:81626778-81626800 CCTCCTCTCCCTTCAAGTTGCAA No data
Right 1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG No data
1120210206_1120210211 12 Left 1120210206 14:81626768-81626790 CCAGTGGCAGCCTCCTCTCCCTT No data
Right 1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG No data
1120210209_1120210211 -6 Left 1120210209 14:81626786-81626808 CCCTTCAAGTTGCAACAACCAAA No data
Right 1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120210211 Original CRISPR ACCAAAAATGTCTTCAGTCA TGG Intergenic
No off target data available for this crispr