ID: 1120214516

View in Genome Browser
Species Human (GRCh38)
Location 14:81668022-81668044
Sequence GGCGGTGCAGACCCAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120214513_1120214516 6 Left 1120214513 14:81667993-81668015 CCTTTGTGGTGAGTGTTACAGCT No data
Right 1120214516 14:81668022-81668044 GGCGGTGCAGACCCAAAGAGTGG No data
1120214511_1120214516 27 Left 1120214511 14:81667972-81667994 CCTCAAGAGTGAAGCTGCAGACC No data
Right 1120214516 14:81668022-81668044 GGCGGTGCAGACCCAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120214516 Original CRISPR GGCGGTGCAGACCCAAAGAG TGG Intergenic