ID: 1120226911

View in Genome Browser
Species Human (GRCh38)
Location 14:81800853-81800875
Sequence ACTGTAGGGTACCGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120226911_1120226916 9 Left 1120226911 14:81800853-81800875 CCAGTGTTTCGGTACCCTACAGT No data
Right 1120226916 14:81800885-81800907 TGGACACATAAAATCACAGTGGG No data
1120226911_1120226915 8 Left 1120226911 14:81800853-81800875 CCAGTGTTTCGGTACCCTACAGT No data
Right 1120226915 14:81800884-81800906 GTGGACACATAAAATCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120226911 Original CRISPR ACTGTAGGGTACCGAAACAC TGG (reversed) Intergenic
No off target data available for this crispr