ID: 1120230341

View in Genome Browser
Species Human (GRCh38)
Location 14:81834913-81834935
Sequence GAGGATCACCTGACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120230341_1120230349 11 Left 1120230341 14:81834913-81834935 CCTCCCAAAGTCAGGTGATCCTC No data
Right 1120230349 14:81834947-81834969 TCCCAAGTAGCTGGGACCACAGG 0: 4135
1: 51604
2: 165139
3: 224358
4: 223435
1120230341_1120230347 2 Left 1120230341 14:81834913-81834935 CCTCCCAAAGTCAGGTGATCCTC No data
Right 1120230347 14:81834938-81834960 ATCTCAGCTTCCCAAGTAGCTGG 0: 96
1: 2800
2: 27300
3: 135748
4: 243344
1120230341_1120230348 3 Left 1120230341 14:81834913-81834935 CCTCCCAAAGTCAGGTGATCCTC No data
Right 1120230348 14:81834939-81834961 TCTCAGCTTCCCAAGTAGCTGGG 0: 395
1: 11942
2: 118272
3: 225037
4: 258303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120230341 Original CRISPR GAGGATCACCTGACTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr