ID: 1120230887

View in Genome Browser
Species Human (GRCh38)
Location 14:81839559-81839581
Sequence AAATTTTAACAGCCTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120230887_1120230891 29 Left 1120230887 14:81839559-81839581 CCAGGTACAGGCTGTTAAAATTT No data
Right 1120230891 14:81839611-81839633 CCTTCTCTACATAACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120230887 Original CRISPR AAATTTTAACAGCCTGTACC TGG (reversed) Intergenic
No off target data available for this crispr