ID: 1120231422

View in Genome Browser
Species Human (GRCh38)
Location 14:81845240-81845262
Sequence GACAGCTGTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120231422_1120231424 15 Left 1120231422 14:81845240-81845262 CCAGTAACAGGCCAACAGCTGTC No data
Right 1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120231422 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr