ID: 1120231424

View in Genome Browser
Species Human (GRCh38)
Location 14:81845278-81845300
Sequence AGTTATCTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120231421_1120231424 22 Left 1120231421 14:81845233-81845255 CCACAGTCCAGTAACAGGCCAAC No data
Right 1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG No data
1120231423_1120231424 4 Left 1120231423 14:81845251-81845273 CCAACAGCTGTCTCTCAGAAGAA No data
Right 1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG No data
1120231422_1120231424 15 Left 1120231422 14:81845240-81845262 CCAGTAACAGGCCAACAGCTGTC No data
Right 1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120231424 Original CRISPR AGTTATCTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr