ID: 1120232149

View in Genome Browser
Species Human (GRCh38)
Location 14:81851488-81851510
Sequence ATGCCCCTTTAGAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120232147_1120232149 2 Left 1120232147 14:81851463-81851485 CCATGGAACTAGGACCTAACAAA No data
Right 1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120232149 Original CRISPR ATGCCCCTTTAGAATAGTGA AGG Intergenic
No off target data available for this crispr