ID: 1120233948

View in Genome Browser
Species Human (GRCh38)
Location 14:81869256-81869278
Sequence CCGAATCTATCAAGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120233942_1120233948 17 Left 1120233942 14:81869216-81869238 CCTGTGTGGAAAGCCTATAATTT No data
Right 1120233948 14:81869256-81869278 CCGAATCTATCAAGTTCTGGAGG No data
1120233943_1120233948 4 Left 1120233943 14:81869229-81869251 CCTATAATTTGAAAAGAACACTA No data
Right 1120233948 14:81869256-81869278 CCGAATCTATCAAGTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120233948 Original CRISPR CCGAATCTATCAAGTTCTGG AGG Intergenic
No off target data available for this crispr