ID: 1120239164

View in Genome Browser
Species Human (GRCh38)
Location 14:81929665-81929687
Sequence GCAATACCACAGAAAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120239164_1120239167 8 Left 1120239164 14:81929665-81929687 CCAAGTTCTTTCTGTGGTATTGC No data
Right 1120239167 14:81929696-81929718 CACTGCCCTTCTCATGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120239164 Original CRISPR GCAATACCACAGAAAGAACT TGG (reversed) Intergenic
No off target data available for this crispr