ID: 1120246638

View in Genome Browser
Species Human (GRCh38)
Location 14:82014099-82014121
Sequence GTGAACAATAGGTCTACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120246638_1120246644 12 Left 1120246638 14:82014099-82014121 CCTAAAGTAGACCTATTGTTCAC No data
Right 1120246644 14:82014134-82014156 ACTACTTGGTACCTACTGAAAGG No data
1120246638_1120246640 -2 Left 1120246638 14:82014099-82014121 CCTAAAGTAGACCTATTGTTCAC No data
Right 1120246640 14:82014120-82014142 ACCCAAGCAATCCTACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120246638 Original CRISPR GTGAACAATAGGTCTACTTT AGG (reversed) Intergenic
No off target data available for this crispr