ID: 1120250743 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:82059676-82059698 |
| Sequence | AATTATCTGCAAATGATGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120250741_1120250743 | 4 | Left | 1120250741 | 14:82059649-82059671 | CCAAGAGTGGTCTCTCAAAAAGA | No data | ||
| Right | 1120250743 | 14:82059676-82059698 | AATTATCTGCAAATGATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120250743 | Original CRISPR | AATTATCTGCAAATGATGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||