ID: 1120250743

View in Genome Browser
Species Human (GRCh38)
Location 14:82059676-82059698
Sequence AATTATCTGCAAATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120250741_1120250743 4 Left 1120250741 14:82059649-82059671 CCAAGAGTGGTCTCTCAAAAAGA No data
Right 1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120250743 Original CRISPR AATTATCTGCAAATGATGGC AGG Intergenic
No off target data available for this crispr