ID: 1120253796

View in Genome Browser
Species Human (GRCh38)
Location 14:82092302-82092324
Sequence TAATATATGCAGAAATACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120253795_1120253796 -3 Left 1120253795 14:82092282-82092304 CCGGACTCTTATTCATGTTATAA No data
Right 1120253796 14:82092302-82092324 TAATATATGCAGAAATACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120253796 Original CRISPR TAATATATGCAGAAATACGA AGG Intergenic
No off target data available for this crispr