ID: 1120256386

View in Genome Browser
Species Human (GRCh38)
Location 14:82124680-82124702
Sequence GATTGTAATTTGCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120256386_1120256388 5 Left 1120256386 14:82124680-82124702 CCAGGAGGAGGCAAATTACAATC No data
Right 1120256388 14:82124708-82124730 TTAATCATAGTGGAATTGAGAGG No data
1120256386_1120256389 13 Left 1120256386 14:82124680-82124702 CCAGGAGGAGGCAAATTACAATC No data
Right 1120256389 14:82124716-82124738 AGTGGAATTGAGAGGCGTTAAGG No data
1120256386_1120256390 16 Left 1120256386 14:82124680-82124702 CCAGGAGGAGGCAAATTACAATC No data
Right 1120256390 14:82124719-82124741 GGAATTGAGAGGCGTTAAGGAGG No data
1120256386_1120256387 -5 Left 1120256386 14:82124680-82124702 CCAGGAGGAGGCAAATTACAATC No data
Right 1120256387 14:82124698-82124720 CAATCAGTTATTAATCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120256386 Original CRISPR GATTGTAATTTGCCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr