ID: 1120259498

View in Genome Browser
Species Human (GRCh38)
Location 14:82163758-82163780
Sequence CTCTTCTCAGCACAGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120259498_1120259502 7 Left 1120259498 14:82163758-82163780 CCCCCTGGCTGTGCTGAGAAGAG No data
Right 1120259502 14:82163788-82163810 TTGTAGTTCTGTTCTTGTTCTGG No data
1120259498_1120259503 8 Left 1120259498 14:82163758-82163780 CCCCCTGGCTGTGCTGAGAAGAG No data
Right 1120259503 14:82163789-82163811 TGTAGTTCTGTTCTTGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120259498 Original CRISPR CTCTTCTCAGCACAGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr