ID: 1120264648

View in Genome Browser
Species Human (GRCh38)
Location 14:82233389-82233411
Sequence GGTTGCACAGAAATACCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120264642_1120264648 -1 Left 1120264642 14:82233367-82233389 CCAGGGGGATAAATTACCCTAGG No data
Right 1120264648 14:82233389-82233411 GGTTGCACAGAAATACCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120264648 Original CRISPR GGTTGCACAGAAATACCCAT GGG Intergenic
No off target data available for this crispr