ID: 1120266092

View in Genome Browser
Species Human (GRCh38)
Location 14:82252562-82252584
Sequence TATTAAGTTATGAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120266088_1120266092 -10 Left 1120266088 14:82252549-82252571 CCCATCTGAGTCATATTAAGTTA No data
Right 1120266092 14:82252562-82252584 TATTAAGTTATGAAAGTGGGTGG No data
1120266086_1120266092 26 Left 1120266086 14:82252513-82252535 CCTAGGTTGGAATAAGTGCTCAA No data
Right 1120266092 14:82252562-82252584 TATTAAGTTATGAAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120266092 Original CRISPR TATTAAGTTATGAAAGTGGG TGG Intergenic
No off target data available for this crispr