ID: 1120269722

View in Genome Browser
Species Human (GRCh38)
Location 14:82296141-82296163
Sequence CCAAGGATGTCTCCGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269722_1120269732 17 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269732 14:82296181-82296203 CTTGAACTGGTTTGCAACACAGG No data
1120269722_1120269734 27 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269734 14:82296191-82296213 TTTGCAACACAGGCGTTCCTGGG No data
1120269722_1120269733 26 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269722_1120269731 4 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269731 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
1120269722_1120269727 -6 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269727 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269722 Original CRISPR CCAAGGATGTCTCCGTCTGA GGG (reversed) Intergenic