ID: 1120269724

View in Genome Browser
Species Human (GRCh38)
Location 14:82296142-82296164
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269724_1120269727 -7 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269727 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
1120269724_1120269732 16 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269732 14:82296181-82296203 CTTGAACTGGTTTGCAACACAGG No data
1120269724_1120269731 3 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269731 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
1120269724_1120269734 26 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269734 14:82296191-82296213 TTTGCAACACAGGCGTTCCTGGG No data
1120269724_1120269733 25 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269724 Original CRISPR GCCAAGGATGTCTCCGTCTG AGG (reversed) Intergenic