ID: 1120269726

View in Genome Browser
Species Human (GRCh38)
Location 14:82296158-82296180
Sequence CCTGACAACCAGGGGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269726_1120269734 10 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269734 14:82296191-82296213 TTTGCAACACAGGCGTTCCTGGG No data
1120269726_1120269736 28 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data
1120269726_1120269733 9 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269726_1120269732 0 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269732 14:82296181-82296203 CTTGAACTGGTTTGCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269726 Original CRISPR CCTGACAACCAGGGGAGCCA AGG (reversed) Intergenic